We narrowed to 657 results for: cat.2

...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...PCR tube Ice Bucket 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 ... reagents on ice): 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 ...normally sterile dH 2 O. To make a 100uM stock of any primer, add a number of µl of dH 2 O equal to the number...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can ...(PCR). Basic PCR Program Initial Denaturation for 2 minutes at 94°C: This initiation step heats the double...target DNA strand accurately and rapidly. Repeat steps 2-4 25-30 times. Final Extension for 5 minutes at 72...

...worn outside of the BSL-2 area. BSL-2 laboratories must be clearly marked as “BSL-2.” The names and contact... biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The purpose of the four levels is to distinguish...in addition to BSL-2 guidelines below, including PPE protocols . Working in a BSL-2 laboratory requires... steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols... Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols and videos...humans, for example, non-pathogenic E . coli . BSL-2 is for labs that work with pathogens including organisms...as Staphylococcus aureus or Vibrio cholerae . BSL-2 includes all of the precautions needed in BSL-1, along...

...materials D.2 Screening for inserts E. Producing Lentiviral Particles E.1 Recommended materials E.2 Protocol...Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector I.2 Recipes I.3 Warranty...VWR: #7177-48-2. Use at 100 μg/mL. Carbenicillin VWR: #80030-956. Use at 100 μg/mL. C.2 Annealing Oligos...oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2 O Incubate for 4 minutes at 95°C in a PCR machine...buffer 1 1 μL AgeI add ddH 2 O to bring to 50 μL final volume Incubate at 37°C for 2 hours. Purify with Qiaquick...buffer for EcoRI 1 μL EcoRI 14 μL ddH 2 O Incubate at 37°C for 2 hours. Run digested DNA on 0.8% low melting... For a standard T4 ligation, mix: 2 μL annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning ...

...430825, 175 cm 2 Cellstack 5, Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269, 1272 cm 2 Heat-inactivated...: 50 mM Tris HCl, 150 mM NaCl, 2 mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working... mL of PBS. Aspirate PBS and add 2 mL of 0.05% Trypsin/EDTA. Wait ~2 min. Neutralize trypsin by adding...Cell-Stack (CS5) (Link opens in a new window) (3,180 cm 2 - the same surface area as 21 x T-175 flasks). Cell...flasks. Workflow Timeline Day 0: Seed cells in CS2 Day 2: Seed cells in CS5 Day 3 (am): Transfect cells Day...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...

...ask new and interesting questions in your own lab. 2. Seek multiple mentors during your postdoc At the ...need? Multiple first or corresponding author publications (published, not in preparation) A history of...The other items will follow. If you get more publications, you will be more competitive for fellowships...to write as well as mentor. Yet, even the most dedicated mentor is not always available for mentees due... project. Furthermore, Group Leader position applications require 3 letters of reference- the graduate...interests, complementary perspectives, a shared communication style. You “get” each other. The other factor...makes time for you, as needed, this is a strong indicator that this person cares about your science and ...

...module_attribute "schema_version" is_json="true" %}{% raw %}2{% endraw %}{% end_module_attribute %}{% module_attribute...the optimal location. It is also important to have good information on the exact location of the TSS. ...appreciable levels of modification. Whole-genome sequencing of cells modified by CRISPR indicates that the consequences...specific base edit, or modulation of gene expression. Location and sequence are important considerations for ... gRNAs. For indels, it's not so important what location in the gene you target, but it is important that...fewer sequences to choose from). Finally, for HDR, location is much more important because you have to target...target site is far more constrained by the desired location of edit; efficiency decreases dramatically when...

...Bachelor's degree Generally a short-term position (1-2 years) Often a gap-year position taken to transition...entire page dedicated to different career options from science policy to science communication and much ...), about their experiences. Research requires dedication and effort, so building a strong understanding...critically about whether it’s something you want to dedicate your time and energy to. How can I make the most... feel less confident in their abilities and qualifications. Studies on imposter syndrome have also found...universities often have scholarships and funds dedicated for undergraduates interested in doing research...the experience would improve my scientific and application writing skills, and ended up with the award. ...

...Single-chain variable fragment (ScFv) Figure 2: Comparison between the IgG antibody and scFv. ...tool that can be used for a variety of research applications. Within the immune system, antibodies are produced...antibodies to bind proteins is useful for research applications as well because they allow scientists to target...150 kDa, a nanobody is 12-15 kDa.   Research applications for antibodies You can use antibodies for experiments...Let’s dive in and take a look at some of these applications. Western blot Western blots are used to detect... by binding to cell surface receptors. These applications are typically used for investigating signaling...are out there, and how many different research applications they can be used for. Addgene’s Antibody Plasmid...

...level 1 (BSL-1) and biosafety level 2 (BSL-2). The BSL-1 classification is for labs working with low-risk...BSL-1 and BSL-2 labs. Protocols... Protocols Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Personal ...Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more protocols ...individuals from potential accidents such as spills. BSL-2 is different because it includes labs that work with...agents associated with diseases in healthy humans. BSL-2 includes all of the precautions needed in BSL-1, however...and/or face shields can be used as needed. For BSL-2 work always wear glasses/goggles in addition to the...

...experience in cancer research After graduating with a 2:1 BSc in Molecular Biology (roughly a B average in...at the Institute of Cancer Research in Sutton, located on the edge of London to gain relevant experience...recession. As each advertised job received many applications, employers were requesting that only scientists...commercial company. In my particular situation, communication between departments was sometimes difficult ... order to have meetings between teams. This communication is vital because otherwise I’d lose touch with...

...Activation 95 10 2 1 Denaturation 94 0.5 2 40 Annealing/Extension 60 1 2 40 Enzyme Deactivation 98 10 2 1 Hold ...diploid cells, thus the reason for multiplying by 2. $$V = 2*{copies\ RRE \over copies\ RPP30}$$ Use the viruses...diluted 2-fold serially, the concentration of RRE positive droplets should decrease by a factor of 2 across...Lentivirus is generally considered biosafety level 2+. Please ensure that you are in compliance with your...channel pipette 200–1000 µL single channel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...Detach cells by incubating with 200 µL TrypLE for 1–2 min. Resuspend cells in 500 µL DMEM complete and transfer... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...

... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high... for viral production) Day 1: Transfect Cells Day 2 (am): 18 h post transfection - Remove media, replace...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container... use. Thawed aliquots should be discarded after 1–2 months. 1 mg/mL polyethylenimine, linear MW 25,000...times a week: Monday: Plate 1x10 6 cells in a 75 cm 2 flask in a volume of 15 mL. Wednesday: Plate 1x10 ...

... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working...μg total DNA to μg PEI ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided...packaging cells Day 1 (pm): Transfect packaging cells Day 2 (am): 18 h post-transfection. Remove media, replace...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...culture plates. Incubate the cells at 37 °C, 5% CO 2 for ~20 h. Prepare a mixture of the three transfection...plasmid using a variety of ratios. Check the cells 1-2 days after transfection to determine what ratio gives...

...follows: Figure 2 Using the box tool, draw a box around the entire first gel lane (as in Figure 2). Select Analyze... Example for AR0018 (lane 2 in Figure 1): Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 (HC)...choose Use Equation . Select the Show R 2 checkbox. Pro-Tip The R 2 of the trendline should be between 0.95...Equipment Heat block 1–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... Add 5 µL of 4X sample buffer to each sample. Add 2 µL 10X reducing agent to each sample. Spin the sample...bottom part of the gel where dye is visible. Section 2: Staining the Gel Place the gel in a plastic tray .... Figure 1 Recombinant antibody preps should have 2 clear bands at ~50 kDa and ~25 kDa corresponding to...

... 95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold ...should decrease by a factor of 2 across the dilutions. In the example below, 2-fold serial dilutions of a ... considered biosafety level 1 but may require BSL-2 handling depending on the insert. Please ensure that...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...Hold 4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software...

...biology 14.6 (2004): 757-764. PubMed PMID: 15582400. 2. Tomkinson, Alan E., et al. "DNA ligases: structure...or DNA base pair mismatches (8-11). For some applications, there cannot be any end-joining activity, and...regions. Why use a high fidelity ligase? Numerous applications have been developed to take advantage of the...Taq and other thermostable DNA ligases. These applications detect specific nucleotide sequences with high...rounds of melting and annealing allows linear amplification of the probe ligation product. With the right...uses two sets of probes to achieve exponential amplification. What does fidelity mean for a ligase? DNA ligases...conditions to be screened per plate. The results indicated that the optimal buffer for Taq DNA Ligase contains...

...transfer, block, incubate with primary antibody Day 2: Incubate with secondary antibody Video Watch this... Microcentrifuge 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...Heat block Mini gel tank chamber Power supply iBlot 2 Gel Transfer Device Roller Spatula Platform shaker...running buffer Prestained protein ladder Ethanol iBlot 2 PVDF Mini Stack, Thermo Fisher IB24002 20X TBS Tween...immediately or store at -80 °C until ready to use. Section 2: Determine the total protein concentration and prepare...in deionized water. To prepare 20% ethanol, dilute 2 mL of ethanol into 8 mL of deionized water and mix...the transfer sandwich as follows: Unseal the iBlot 2 PVDF Mini transfer stack. Set the Top Stack to one...

...effective recovery of knock-ins, but did result in 1-2 kilobases of additional sequence being introduced....Mello lab also reported that modifying the 5’ modification of oligos used to generate linear dsDNA repair...Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. ...Forstemann K (2014) Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination...Watts JK, Sontheimer EJ, Mello CC (2018) 5′ Modifications Improve Potency and Efficacy of DNA Donors for...Colaiácovo MP (2013) Heritable Custom Genomic Modifications inCaenorhabditis elegansvia a CRISPR–Cas9 System...

...method 1) or the volume of virus (method 2): Method 1 Method 2 $$T = {N*F*D\over V_T}$$ Where: T = Titer...downstream applications. Safety Warnings Lentivirus is generally considered biosafety level 2+. Please ...Day 0: Seed 293T cells Day 1: Transduce cells Day 2 (am): Remove media, replace with fresh media Day 4...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel... 200–1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container...complete. Mix well by pipetting or inverting. Aliquot 2 mL of cell suspension into each well of the 6-well...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...

...cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in a PCR tube. Place tube in a ...a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo...