Skip to main content
Addgene
Showing: 601 - 620 of 653 results
  1. Transferable Skills Guide: Conflict Resolution

    Type
    Blog Post
    ...become a valuable asset yourself.     Fig 2: A diagram of the Thomas-Kilmann Conflict Model, courtesy...conflict is not always what was communicated but how it was communicated. The next step is to come up with...of lapsed communication. Making some assumptions about how something should be communicated is necessary...skill in and of itself. Conflict can also be categorized as either “personal” or “substantive”. A personality-based...traced back to one of a few trouble spots:  Communication (or lack thereof): Information sharing gets ...organization gets, and creating new avenues of communication can create as many problems as it can solve....meeting? Different teams frequently prefer to communicate in different ways, so the source of the conflict...
  2. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...two visible blue or magenta chromoproteins (Figure 2) (Liljeruhm et al., 2018). This system is a nice confirmation...resistance cassette, and the R6K origin of replication to allow replication only in hosts carrying the bacteriophage...chromosome. These methods roughly fall into two categories: those that rely on exogenous enzymes and those...Lambda Red recombineering, which uses enzymes domesticated from the Lambda bacteriophage, is arguably the...enzymes can also accomplish the desired genomic modification. This technique is frequently called allelic...recipient of interest. Because pDS132 cannot be replicated in the recipient, the only antibiotic resistant...exchange. To do this, we performed the following modifications to pDS132 (Philippe et al., 2004): Replaced...
  3. Targeting HIV-1 with CRISPR: Shock and Kill or Cut it Out?

    Type
    Blog Post
    ...excise the HIV-1 genome from every infected cell and 2. prevent reinfection of those cells. Kaminski et al...pre-treatment levels due to the viral reservoirs located in latently infected cells. Although ART-treated...toxic proteins, CRISPR/Cas9 SAM caused apoptosis, indicating a true “shock and kill” response. Cutting HIV...create mutations in genes essential to HIV-1 replication. However, this approach could permit some viral...along with Cas9 in the T-cell line 2D10. PCR amplification and Sanger sequencing of pooled samples showed... HIV-1 could escape from CRISPR/Cas9-induced modification targeting either the LTRs or essential genes...genes. Many of these escape mutations were located near the Cas9 cut site, leading Wang et al. to conclude...
  4. Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection

    Type
    Blog Post
    ..., whereas the mVenus-APT1 fusion does not (figure 2). In the mVenus-APT1, a lipidation motif, which is...study its function is one of the most popular applications of fluorescent proteins. These fusion proteins...steric hindrance. For instance, GFP may occlude catalytic sites or obstruct binding sites or motifs that...that are necessary for post-translational modifications. Despite these potential issues, GFP has been used...linker sequence short In the early days of GFP applications, many were concerned with steric hindrance by...N-terminus of the donor fluorescent protein can be truncated to increase the FRET efficiency. Creating fusions...fluorescent protein and protein of interest (POI). To indicate the sequence, people often use terminology like...
  5. Plasmids 101: Gibson Assembly and Other Long-Homology Based Cloning Methods

    Type
    Blog Post
    ... Methods 2009; 6, 343-345. PubMed PMID: 19363495. 2. Wang JW, Wang A, Li K, Wang B, Jin S, Reiser M, Lockey...neighboring fragments can be created via PCR amplification with primers that contain the appropriate homologous... tools that help you design primers for PCR amplification of fragments to incorporate such regions of ...assembly meets CRISPR Gibson can be adapted to more complicated cloning schemes, such as those where the vector...CRISPR technology and is described in a recent publication by the Lockey lab (Wang, et al. 2015). In this...aspects of the SLIC methods. First, it uses a dedicated 5’ exonuclease instead of using the exonuclease...DNA fragments contain these sites at the correct location and NOT in the middle of your insert. Gateway ...
  6. CRISPR 101: Any Base Transversion Editors

    Type
    Blog Post
    ... Figure 2: Mechanisms of deaminase-based adenine transversion editors. Red arrows indicate a conversion...conversion directly catalyzed by the base editor. Black arrows indicate natural cellular processes. Created...researchers can now select the best tool for their application from among many options.  Conclusion With these...engineered human uracil DNA glycosylase. Nature Communications, 15(1), 4897. https://doi.org/10.1038/s41467...via engineered uracil-DNA glycosylase. Nature Communications, 15(1), 6397. https://doi.org/10.1038/s41467...
  7. Molecular Biology Reference

    Type
    Guide
    ...antibiotic. Unless otherwise indicated, the antibiotic powder can be dissolved in dH 2 0. Addgene recommends ... Origin of Replication ( ori ) DNA sequence which directs initiation of plasmid replication (by bacteria... Educational Resources Molecular Biology Reference Molecular...plasmid selection DNA sequencing for plasmid verification Resources Genetic Code Webpage and Blog References...Techniques in chemistry enable isolation and purification of cellular components, such as DNA, but practically...double-stranded DNA that typically carry genes and can replicate independently from chromosomal DNA. Although they...the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and each daughter cell receives...
  8. Building Global Connections with the International Mentorship Program USA-EUROPE

    Type
    Blog Post
    ...15.4%) 46 (59%) of these students were in the last 2 years of their degree. Students filled in a pre-program...Universities from five different geographical locations in Spain were enrolled: the University of Valencia...2014/2015, took place on July 27th, 2015 at a dedicated international mentoring conference held at the... own part, mentors receive immense personal gratification as they witness their student’s progress and...like IMP build bridges and global networks. They catalyze the development of knowledge, experience, resources...Mentoring Foundation for the Advancemnet of Higher Education website Resources at Addgene Read Other Career...
  9. Five Popular Model Organisms

    Type
    Blog Post
    ...variety of environmental conditions, and double every 2 hours. Yeast are also the first eukaryotic genome ... throughout their lifetime. Thus any genetic modification, such as expression of fluorescent protein or...studying somatic mutations and cancer." Nature Education 1.1 (2008): 183. Zuber, Johannes, et al. "Mouse...
  10. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ... 10 90 2 x 10 8 10 of 2 x 10 8 dilution 90 2 x 10 7 10 of 2 x 10 7 dilution 90 2 x 10 6 10 of 2 x 10 6...6 dilution 90 2 x 10 5 10 of 2 x 10 5 dilution 90 2 x 10 4 10 of 2 x 10 4 dilution 90 2 x 10 3 Pro-Tip...dilutions, in duplicate, of your standard curve plasmid (2 x 10 9 stock made in step #1): Volume of 2 x 10 9 ...molecules/μL To obtain a solution at 2 x 10 9 molecules/μL: 1.59 x 10 11 / 2 x 10 9 = 79.8X dilution ...stock 45 uL 10X 10X Dilution 2 5 uL Dil. 1 95 uL 20X 200X Dilution 3 20 uL Dil. 2 80 uL 5X 1000X Dilution ...valid 8-point standard curve. Figure 2: Example of the amplification plots obtained from an AAV sample. ...PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal...
  11. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...Figure 2: A) When proteins (blue) interact with the air-water interface (AWI) before vitrification, they...beads through an assembly of biotinylated SpyTag-SpyCatcher linkers and spacer proteins ending with a GFP... (Figure 1). This enrichment streamlines the purification and minimizes sample loss while also supporting...scFvs for other targets or could be used for applications beyond cryo-EM.   Find plasmids for MagIC-Cryo-EM...chemical crosslinking or tilted-stage imaging. A truncated form of a tardigrade LEA, RvLEAMshort, protected...optimizing prime editing systems for specific applications! Delivering prime editors (PEs) via engineered...be delivered in a single package. In a recent publication, the Liu lab showed that this method of delivery...
  12. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...improvement in muscle physiological performance.  2. Trans-splicing Overview: For trans-plicing, splice...that the oversized AAV genomes are fragmented or truncated when packaged and then following transduction,...and may need to be optimized for each unique application (Trapani et al., 2015).  Expression of smaller...transgene to help prevent the accumulation of such truncated proteins. Examples of use:  Ghosh et al., 2008...design, donor A may be capable of expressing a truncated protein. This can be avoided by excluding a stop...JS (2011) Gene Therapy of mdx Mice With Large Truncated Dystrophins Generated by Recombination Using rAAV6...Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina ...
  13. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...PCR tube Ice Bucket 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 ... reagents on ice): 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 ...normally sterile dH 2 O. To make a 100uM stock of any primer, add a number of µl of dH 2 O equal to the number...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can ...(PCR). Basic PCR Program Initial Denaturation for 2 minutes at 94°C: This initiation step heats the double...target DNA strand accurately and rapidly. Repeat steps 2-4 25-30 times. Final Extension for 5 minutes at 72...
  14. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ...signal separately for each target.   Figure 2: Examples of simultaneous multiplex IF labeling of...protein is (localization) and how much there is (quantification). But what if you’ve got several interesting...primary antibodies that have been validated in IF applications (find IHC validated or ICC validated antibodies...informative image-based figures for scientific publications. PLOS Biology, 19(3), e3001161. https://doi....Immunocytochemistry Protocols for other antibody applications...
  15. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...worn outside of the BSL-2 area. BSL-2 laboratories must be clearly marked as “BSL-2.” The names and contact... biosafety level 1 (BSL-1) and biosafety level 2 (BSL-2). The purpose of the four levels is to distinguish...in addition to BSL-2 guidelines below, including PPE protocols . Working in a BSL-2 laboratory requires... steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols... Biosafety Levels One and Two (BSL-1 and BSL-2) Intro to the Lab Bench Check out more protocols and videos...humans, for example, non-pathogenic E . coli . BSL-2 is for labs that work with pathogens including organisms...as Staphylococcus aureus or Vibrio cholerae . BSL-2 includes all of the precautions needed in BSL-1, along...
  16. CRISPR Library Amplification

    Type
    Protocol
    ... recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be performed at the... day to ensure that growth times are limited. Day 2: Harvest cells and purify DNA (Estimated time 3-4 ... Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate transformations...has been absorbed by the agar. This usually takes 1-2 minutes. Critical Be careful not to rip or shred the...incubation if needed. Place 100 mL sterile LB at 4 ℃. Day 2 (morning) Before beginning, prechill at least four...pellet. The total weight of each pellet should be ~1-2 g. Pro-Tip Make sure to weigh the empty tube beforehand... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...
  17. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...materials D.2 Screening for inserts E. Producing Lentiviral Particles E.1 Recommended materials E.2 Protocol...Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector I.2 Recipes I.3 Warranty...VWR: #7177-48-2. Use at 100 μg/mL. Carbenicillin VWR: #80030-956. Use at 100 μg/mL. C.2 Annealing Oligos...oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH 2 O Incubate for 4 minutes at 95°C in a PCR machine...buffer 1 1 μL AgeI add ddH 2 O to bring to 50 μL final volume Incubate at 37°C for 2 hours. Purify with Qiaquick...buffer for EcoRI 1 μL EcoRI 14 μL ddH 2 O Incubate at 37°C for 2 hours. Run digested DNA on 0.8% low melting... For a standard T4 ligation, mix: 2 μL annealed oligo from step C.2 20 ng digested pLKO.1 TRC-cloning ...
  18. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in a PCR tube. Place tube in a ...a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo...
  19. AAV Production in HEK293 Cells

    Type
    Protocol
    ...430825, 175 cm 2 Cellstack 5, Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269, 1272 cm 2 Heat-inactivated...: 50 mM Tris HCl, 150 mM NaCl, 2 mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized... solution can be stored at 4 °C for up to 2 months. After 2 months, discard the tube and thaw a new working... mL of PBS. Aspirate PBS and add 2 mL of 0.05% Trypsin/EDTA. Wait ~2 min. Neutralize trypsin by adding...Cell-Stack (CS5) (Link opens in a new window) (3,180 cm 2 - the same surface area as 21 x T-175 flasks). Cell...flasks. Workflow Timeline Day 0: Seed cells in CS2 Day 2: Seed cells in CS5 Day 3 (am): Transfect cells Day...Biological Safety Cabinet 0.5–10 µL single channel pipette 2–20 µL single channel pipette 20–200 µL single channel...
  20. Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs

    Type
    Protocol
    ...level 1 (BSL-1) and biosafety level 2 (BSL-2). The BSL-1 classification is for labs working with low-risk...BSL-1 and BSL-2 labs. Protocols... Protocols Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Personal ...Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Intro to the Lab Bench Check out more protocols ...individuals from potential accidents such as spills. BSL-2 is different because it includes labs that work with...agents associated with diseases in healthy humans. BSL-2 includes all of the precautions needed in BSL-1, however...and/or face shields can be used as needed. For BSL-2 work always wear glasses/goggles in addition to the...
Showing: 601 - 620 of 653 results