We narrowed to 613 results for: SET
-
TypeBlog Post...Imaging of the cross-presenting dendritic cell subsets in the skin-draining lymph node." Proceedings of...
-
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...after completing her postdoctoral training from Massachusetts General Hospital and Harvard Medical School.... -
General Transfection
TypeProtocol... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high... -
Lentivirus Production
TypeProtocol...were transfected with the GFP-expression plasmid pRosetta using μg total DNA to μg PEI ratios of 1:1, 1:... -
Colony Formation Titering Assay
TypeProtocol...indicated serial dilutions of the lentiviral vector pRosetta . The following day, cells were treated with puromycin... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...especially in the corner of the well as cells tend to settle there. Once the cells have expanded but before ... -
Antibody Guide
TypeGuide...non-biological replicates) often each require their own set of controls. Multiplex Assays Flow cytometry, IF,... cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires...requires single-antibody controls, a small subset of the sample labeled with only one antibody, for each ... -
Adenovirus Guide
TypeGuide...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. Vaccine Development... -
Sequencing Primers
TypeGuide... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer... -
CRISPR Guide
TypeGuide..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants... -
Adeno-associated virus (AAV) Guide
TypeGuide...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain... -
Chemogenetics Guide
TypeGuide...and inhibiting DREADDs in the same experimental setup) were not possible. To overcome this limitation,... -
Optogenetics Guide
TypeGuide...below, can be targeted and expressed in specific subsets of neurons, allowing precise spatiotemporal control...