We narrowed to 618 results for: Set
-
TypeBlog Post...course of infection, when HIV-1 is limited to a subset of T-cells, but it is unclear if enough T-cells...
-
Thoughts on the Future of Research 2015 Boston Symposium
TypeBlog Post...training in the academic research environment is setup to prepare trainees for further work in academia... -
Viral Vectors 101: Optogenetic Tools
TypeBlog Post...Figure 1: Example of an experimental optogenetic setup. A light source delivers light pulses to the subject... -
Viral Vectors 101: AAV Variables That Matter
TypeBlog Post...adeno-associated viral vector serotypes 1, 2, 5, 8 and 9 in marmoset, mouse and macaque cerebral cortex. Neuroscience... -
Antibodies 101: Antibody Engineering and Directed Evolution
TypeBlog Post...; font-weight: normal; text-decoration: none","font_set":"DEFAULT"},"button_hover_color":{"color":"#0052a9... -
Live and Let Dye: Self-Labeling Protein Tags
TypeBlog Post...emission depletion (STED) nanoscopy. Scale bar, 2 μm. Inset shows comparison with standard confocal microscopy... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...Imaging of the cross-presenting dendritic cell subsets in the skin-draining lymph node." Proceedings of... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...after completing her postdoctoral training from Massachusetts General Hospital and Harvard Medical School.... -
General Transfection
TypeProtocol... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high... -
Lentivirus Production
TypeProtocol...were transfected with the GFP-expression plasmid pRosetta using μg total DNA to μg PEI ratios of 1:1, 1:... -
Colony Formation Titering Assay
TypeProtocol...indicated serial dilutions of the lentiviral vector pRosetta . The following day, cells were treated with puromycin... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...especially in the corner of the well as cells tend to settle there. Once the cells have expanded but before ... -
Adenovirus Guide
TypeGuide...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. Vaccine Development... -
Sequencing Primers
TypeGuide... end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA... -
CRISPR Guide
TypeGuide..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants... -
Adeno-associated virus (AAV) Guide
TypeGuide...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain... -
Chemogenetics Guide
TypeGuide...and inhibiting DREADDs in the same experimental setup) were not possible. To overcome this limitation,... -
Optogenetics Guide
TypeGuide...below, can be targeted and expressed in specific subsets of neurons, allowing precise spatiotemporal control...