We narrowed to 617 results for: Set
-
TypeBlog Post...; font-weight: normal; text-decoration: none","font_set":"DEFAULT"},"button_hover_color":{"color":"#0052a9...
-
Live and Let Dye: Self-Labeling Protein Tags
TypeBlog Post...emission depletion (STED) nanoscopy. Scale bar, 2 μm. Inset shows comparison with standard confocal microscopy... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...Imaging of the cross-presenting dendritic cell subsets in the skin-draining lymph node." Proceedings of... -
Cloning
TypeGuide...fuse. A major disadvantage is that you need to be set up to grow, transform and purify DNA from yeast. ...promoters and into backbones with different selection cassettes). Although gateway cloning is a simple and efficient... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...after completing her postdoctoral training from Massachusetts General Hospital and Harvard Medical School.... -
General Transfection
TypeProtocol... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high... -
Lentivirus Production
TypeProtocol...were transfected with the GFP-expression plasmid pRosetta using μg total DNA to μg PEI ratios of 1:1, 1:... -
Colony Formation Titering Assay
TypeProtocol...indicated serial dilutions of the lentiviral vector pRosetta . The following day, cells were treated with puromycin... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...especially in the corner of the well as cells tend to settle there. Once the cells have expanded but before ... -
Plan Your Experiment
TypeGuide... you started using CRISPR in your research and setting up CRISPR experiments. We will focus on making ...DNA to serve as template for the repair. Once you settle on your gRNA, you can design a donor DNA to have...variety of modifications and will likely contain a subset of wild type cells. If you are screening a variety... -
Antibody Guide
TypeGuide...non-biological replicates) often each require their own set of controls. Multiplex Assays Flow cytometry, IF,... cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires...requires single-antibody controls, a small subset of the sample labeled with only one antibody, for each ... -
Adenovirus Guide
TypeGuide...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. Vaccine Development... -
Sequencing Primers
TypeGuide... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer... -
CRISPR Guide
TypeGuide..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants... -
Adeno-associated virus (AAV) Guide
TypeGuide...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain... -
Chemogenetics Guide
TypeGuide...and inhibiting DREADDs in the same experimental setup) were not possible. To overcome this limitation,... -
Optogenetics Guide
TypeGuide...below, can be targeted and expressed in specific subsets of neurons, allowing precise spatiotemporal control...