We narrowed to 616 results for: Set

...Figure 1: Example of an experimental optogenetic setup. A light source delivers light pulses to the subject...

...adeno-associated viral vector serotypes 1, 2, 5, 8 and 9 in marmoset, mouse and macaque cerebral cortex. Neuroscience...

...; font-weight: normal; text-decoration: none","font_set":"DEFAULT"},"button_hover_color":{"color":"#0052a9...

...emission depletion (STED) nanoscopy. Scale bar, 2 μm. Inset shows comparison with standard confocal microscopy...

...Imaging of the cross-presenting dendritic cell subsets in the skin-draining lymph node." Proceedings of...

...after completing her postdoctoral training from Massachusetts General Hospital and Harvard Medical School....

... transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high...

...were transfected with the GFP-expression plasmid pRosetta using μg total DNA to μg PEI ratios of 1:1, 1:...

...indicated serial dilutions of the lentiviral vector pRosetta . The following day, cells were treated with puromycin...

...especially in the corner of the well as cells tend to settle there. Once the cells have expanded but before ...

...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. Vaccine Development...

... end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...

..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants...

...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...

...and inhibiting DREADDs in the same experimental setup) were not possible. To overcome this limitation,...

...below, can be targeted and expressed in specific subsets of neurons, allowing precise spatiotemporal control...