Skip to main content

We narrowed to 14 results for: Set

Showing: 1 - 14 of 14 results
  1. Guide to Using Pooled Libraries

    Type
    Guide
    ...selection mechanism. You’ll infect two sets of cells and subject one set to selection while the other serves...genome, while others are restricted to certain gene sets. In cDNA libraries, each plasmid contains a unique... be small, if they are designed to cover only a subset of genes, or very large (e.g., the Toronto KnockOut...
  2. Modular Cloning Guide

    Type
    Guide
    ...plasmids from different combinations of a common set of components (Weber et al., 2011). This method, ...tools, and more. The MoClo system consists of three sets of cloning vectors (Level 0, 1, and 2) which can...Bacterial Expression Thorsten Mascher , Georg Fritz Two sets of plasmids to generate constructs for Lactiplantibacillus...create plant expression vectors containing several cassettes and generate multi-construct transgenic plants...protein complexes in various hosts. Expression cassettes for individual subunits are first assembled by...
  3. Molecular Biology Reference

    Type
    Guide
    ...from DNA. The Genetic Code The genetic code is a set of rules for translating the information encoded ...replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term, either...Genetic Code The genetic code can be defined as a set of rules for translating the information encoded ...
  4. Science Guides

    Type
    Guide
    ...genome, while others are restricted to certain gene sets. Read More Viral Vectors Find educational guides...
  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... vectors that can be safely used in laboratory settings. These engineered gamma-retroviral vectors have...safety when producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...
  6. Lentiviral Vector Guide

    Type
    Guide
    ... vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have many...lentiviral vectors are also popular in clinical settings for the delivery of gene therapies. Lentiviral...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...
  7. Plan Your Experiment

    Type
    Guide
    ... you started using CRISPR in your research and setting up CRISPR experiments. We will focus on making ...DNA to serve as template for the repair. Once you settle on your gRNA, you can design a donor DNA to have...variety of modifications and will likely contain a subset of wild type cells. If you are screening a variety...
  8. Antibody Guide

    Type
    Guide
    ...non-biological replicates) often each require their own set of controls. Multiplex Assays Flow cytometry, IF,... cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires...requires single-antibody controls, a small subset of the sample labeled with only one antibody, for each ...
  9. Adenovirus Guide

    Type
    Guide
    ...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. Vaccine Development...
  10. Sequencing Primers

    Type
    Guide
    ... end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...
  11. CRISPR Guide

    Type
    Guide
    ..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants...
  12. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...
  13. Chemogenetics Guide

    Type
    Guide
    ...and inhibiting DREADDs in the same experimental setup) were not possible. To overcome this limitation,...
  14. Optogenetics Guide

    Type
    Guide
    ...below, can be targeted and expressed in specific subsets of neurons, allowing precise spatiotemporal control...
Showing: 1 - 14 of 14 results