...selection mechanism. You’ll infect two sets of cells and subject one set to selection while the other serves...genome, while others are restricted to certain gene sets. In cDNA libraries, each plasmid contains a unique... be small, if they are designed to cover only a subset of genes, or very large (e.g. the Toronto KnockOut...

...genome, while others are restricted to certain gene sets. Read More Viral Vectors Find educational guides...

...replicated easily and efficiently in a laboratory setting. Stable - Plasmids are stable long-term either ... in many species and can be useful for a diverse set of applications - Plasmids can drive gene expression...Genetic Code The genetic code can be defined as a set of rules for translating the information encoded ...

... vectors that can be safely used in laboratory settings. These engineered gamma-retroviral vectors have...safety when producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus genome. Created...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...

... vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have many...lentiviral vectors are also popular in clinical settings for the delivery of gene therapies. Lentiviral...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...

...fuse. A major disadvantage is that you need to be set up to grow, transform and purify DNA from yeast. ...promoters and into backbones with different selection cassettes). Although gateway cloning is a simple and efficient...

...to NHEJ knockout. Base editors can make a limited set of mutations. Repress or Interfere (CRISPRi) Reduce...

...non-biological replicates) often each require their own set of controls. Multiplex Assays Flow cytometry, IF,... cytometry requires a negative control, a small subset of the sample with no antibodies. It also requires...requires single-antibody controls, a small subset of the sample labeled with only one antibody, for each ...

...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...protein-coding genes and complex gene expression cassettes are often too big to be packaged in rAAV vectors...enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. Vaccine Development...

... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer...

..., D., Romanel, A., Demichelis, F., Inga, A., & Cereseto, A. (2018). A highly specific SpCas9 variant is...Protocols in Molecular Biology . 115 . PMID: 27366891 Rousset, F., Cui, L., Siouve, E., Becavin, C., Depardieu... M. W., Yamano, T., Nishimasu, H., Nureki, O., Crosetto, N., & Zhang, F. (2017). Engineered Cpf1 variants...

...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...

...and inhibiting DREADDs in the same experimental setup) were not possible. To overcome this limitation,...

...below, can be targeted and expressed in specific subsets of neurons, allowing precise spatiotemporal control...