Skip to main content

We narrowed to 532 results for: abo.3

Showing: 311 - 320 of 532 results
  1. Changing Labor Laws Bring Increased Postdoc Wages

    Type
    Blog Post
    ...be automatically adjusted every 3 years. In May 2016, Secretary of Labor Thomas Perez updated the overtime...the Addgene Blog How did this change in labor laws come about? In March 2014, the White House issued a...must be above this level, and certain job duty tests must be met. In the Department of Labor’s general... to $47,476 per year, under updates to the Fair Labor Standards Act (FLSA). This is having a major effect...ensuring that either all affected scientists are paid above this threshold or for tracking the hours that these... a memorandum to the Secretary of Labor to update the FLSA, which had not seen revisions since 2004. In... In July 2015, the Department of Labor issued a Notice of Proposed Rulemaking, soliciting feedback by ...
  2. Technical Design of a Western Blot

    Type
    Blog Post
    ...Tris-acetate 40–500 kDa Tris-tricine 150 V, 1–3 hours Good for higher weight proteins Long running...very large proteins. A semi-dry transfer is faster — 3–30 minutes — and uses less buffer, but it is not as...approaches best suit your experimental needs. Table 3: Optimizing the technical design of a western blot...If you’ve ever run a western blot, or thought about running one, you’ll know there’s a lot of choices...
  3. Six Spooky Science Stories and Halloween at Addgene

    Type
    Blog Post
    ...cyanobacterium Vampirovibrio chlorellavorus." PeerJ 3 (2015): e968. PubMed PMID: 26038723. PubMed Central... Additional resources on the Addgene blog Read about company culture at Addgene See some of our previous...
  4. 6 Steps to Submitting a Resume That Gets Seen

    Type
    Blog Post
    ...for more on timely submission of a job application. 3) Read job descriptions carefully Be open minded and... your strengths in your resume and don't be shy about asking for help. The worst thing that can happen...
  5. The Stingy Scientist: How the Baby Gel Box Was Born

    Type
    Blog Post
    ...to wash Eppendorf tubes which were to be used for 3 months before they could be discarded.  Seeding Labs...Reddit AMA  Few of us spend much time thinking about conserving resources in the labs. Disposable plastic...Dudnik, Founder of Seeding Labs, tells the story about working as a student in a rice lab in the Ivory ...didn’t feel the need to reuse plasticware or think about conserving reagents and buffers.  However, I had...environmentally conscious friends who had me thinking about energy conservation even before it was a popular...Turns out, one could make a lifetime supply for about $10 US dollars worth of glass powder pruchased from...So, I designed my own gel box (see illustration above) and bribed the guys in the hospital machine shop...
  6. A Better Way to Get Customer Support: The Help Center

    Type
    Blog Post
    ...it doesn’t help much if the actual response takes 3 days and still doesn’t even answer your question. ...not even get a solution to the problem you called about. Next, you try an email, given that this is the ...” next to an encircled question mark (see image above). This useful widget allows you to access our Help... or you just have a general question or concern about the answers we provide, within the widget you also...Addgene Blog Read other Inside Addgene Posts Learn about New Features on Our Plasmid Pages Resources at ...
  7. We're Updating Our Hold for Publication Policy

    Type
    Blog Post
    ... a journal publication. Plasmids will be released 3 years after the deposit date. Don’t worry, we’ll ... in the hold status and reach out to depositors about them, but we all know how easy it is to miss an ...happy to distribute unpublished materials. What about preprints? Addgene supports preprints and encourages...appreciate your feedback. If you have questions about depositing, check out our website, Help Center, ...
  8. Viral Vectors 101: Parts of the AAV Packaging Plasmid

    Type
    Blog Post
    ...plasmid, which contain regions of dsDNA. To generate a 3’ hydroxyl group needed for DNA replication, Rep78/...engineered Learn about the parts of the AAV transfer plasmid  Resources on Addgene.org Learn about AAV Find ...plasmid! Check out this blog post to learn more about the AAV transfer plasmid! References: Naso MF...
  9. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - ...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3' Note: If you plan to...CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other oligo),...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate ...
  10. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ...C-terminus (3xHA, 13xMyc, GST, or GFP). Longtine et al.(3) describe a complimentary set of plasmids for use ...strain. In addition to the collections featured above, many other modular yeast tagging systems have been...Addgene would love to hear from you, our community, about your experience with yeast genome modifications....
Showing: 311 - 320 of 532 results