... cells, as well as in cortical neurons in layer 2/3 of the mouse brain. Rubin’s work shows that the yeast...site-specific recombination in Drosophila, read on to learn about new recombinases suitable for this system. Gerald...recombinases from the Rubin lab For more information about limitations and caveats of Cre usage: Vagaries of...

...community. These popular plasmids are categorized into a 3-level system on our website:   A yellow flame indicates...Flame awardee Sophien Kamoun of the Sainsbury Laboratory in Norwich, UK: “We’re very pleased to distribute...Plasmid in 2015 Find Hot Plasmid Technologies Write about Your Favorite Plasmid Technology Resources on Addgene.org...

...for particular screens of interest.   Figure 3: Each publication featured in BioGRID ORCS has a dedicated...resources on the Addgene blog Read this blog post about genome-wide screening using CRISPR Find all of our...on Addgene.org Read our CRISPR guide Learn more about plasmid pooled libraries Find CRISPR plasmids for...

... term sgRNA. Seed sequence: The 8-10 bases on the 3’ end of an RNA guide (either crRNA or sgRNA). Cas9...used to target complementary DNA sequences. In laboratory settings, an sgRNA includes the crRNA and tracrRNA...itself, simplifying the CRISPR-Cas9 system for laboratory applications. At Addgene, we sometimes refer ...

...Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense is also commonly ...with single-spike temporal resolution. PLoS One. 2(3):e299. PMID 17375185 Kim B, Lin MZ. 2013. Optobiology...excitation of distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User’s Guide...control of neural activity. Cold Spring Harb Protoc. 3:top102. PMID 21363959 Yizhar O, Fenno LE, Prigge M...derived from Volvox carteri. Nat Neurosci. 11(6):631-3. PMID 18432196... to permit CIB1 binding. As shown in the figure above, this light induced binding can be utilized to control...dimerization. In addition to the applications described above, both LOV and Dronpa can control activity of a fused...

...' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - ...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT...AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3' Note: If you plan to...CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other oligo),...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source...vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate ...

...Furthermore, Group Leader position applications require 3 letters of reference- the graduate school mentor, ...yourself to and talk with more senior scientists. 3. Work intensely, but intelligently Before you do your...Nature and Science, for example). This blog post is about how to get the most out of your postdoctoral training...your new model?  PFs need to be regularly thinking about manuscripts. The other items will follow. If you...this is a strong indicator that this person cares about your science and your development. Taken together...Researchers face a fundamental conflict. Science is about exploration, discovering new information. There ...many PFs are reluctant to give talks or posters about their research. They dread giving a departmental...

...fluorescent protein. Nat Methods. 2009 Feb 6(2):131-3.  PubMed. Find plasmids from this publication at...this protein has a few more secrets - during a collaboration, members of Maureen Hanson’s and Rima Menassa's...

... 6–8 weeks Average shipping time: 1–2 days (USA); 3–4 days (international; varies widely by country and...educational resources.  We hope you’re as excited about this expansion as we are! Happy packaging! ...

...fluorescent proteins. Krumholz et al (Sci Rep. 2014 Feb 3; 4:3939. doi: 10.1038/srep03939.)  ... absorbance of water, which absorbs wavelengths above 900 nm or so. In other words, wavelengths between...