...Facebook and Gmail, were launched. And Melina Fan, a cell biology graduate student, was frustrated by the ...to receive the Massachusetts Nonprofit Network Excellence Award for our electronic MTA system. We also ...

...following panel members: Jonathan Dinman, Chair of the Cell Biology and Molecular Genetics Department at University...

...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...

...Cambridge University where he studied mechanisms of cell division. Recently Seán got the entrepreneurial ...research (either because of expertise, equipment, or excellence of the institution). Likewise, if you’re staying...

...our set up. The cooling block is used to keep our cells from warming up too much and dying.  Also, we added...

...Precise and efficient scarless genome editing in stem cells using CORRECT. Nat Protoc 12, 329–354 (2017). DOI...

...for Light and Electron Microscopy. In Methods in Cell Biology (pp. 283–310). Elsevier. https://doi.org...

... Innovative Neurotechnologies (BRAIN) Initiative Cell Census Network, the Wu lab will be screening over...

...with appropriate flanking homology into a germline cell can create an RNA-guided gene drive. In principle...

...Scientist at AstraZeneca. She has a background in cell and developmental biology and is applying this towards...

...compelling photos and videos, while molecular, micro, and cell biology are often more suited for cartoons or graphics...

...request? Your colleague is if someone can feed their cells this weekend - why? Do they have an important plans...

...Promoters: Select the best promoter for your target cell type Serotype: Choose the AAV capsid or lentiviral...

...such as some of our viral vectors, in NEB Stable cells. Resource information: This section contains information...analyzed using Addgene’s Analyze Sequence tool. Excellent, how can I check if the plasmid will be within...

...really easy to clone genes for expression in plant cells. Sylvester and I chose the 96 most useful things...

...attend. Societies, such as the American Society for Cell Biology (ASCB) or the American Chemical Society ...

...issue was with a custom-made reagent to manipulate cells (manufactured by one of the larger biotech companies...Specifically, roles in technical support make excellent use of the skills developed by life science PhDs...about novel developments in the fields of gene and cellular therapies.     Additional Resources on the Addgene...

...the mesocorticolimbic system in addiction. Front Cell Neurosci. 2014;8:466. PubMed PMID: 25653591. PubMed...

...used in the detection of rare sequences and single cell analysis. It is also being used in the detection...

...visible whether expressed in E. coli, in mammalian cells, or in purified form, and didn’t need any added ...