We narrowed to 258 results for: gfp gene

...read-through transcripts of the effector gene. Effector genes, any gene that you want to control the expression...chemical inducers of gene expression (del Valle Rodríguez et al., 2011).  Genetics of SPARC Figure...Learn more about controlling gene expression in flies Resources on Addgene.org Find fluorescent protein...truncated attP sites to control recombination of the gene construct. A predictable number of cells will express...binds to the UAS binding motif, driving downstream gene expression. attP and attB, recombination sites. ...side of a stop cassette, upstream of an effector gene. In cells where the stop cassette is removed during...expression of either a stop cassette or an effector gene. HDVR (2X Hepatitis Delta Virus Ribozyme), a self-cleaving...

...typically include a gene that is advantageous for survival, such as an antibiotic resistance gene. In contrast...the target gene. Vital component for expression vectors: determines which cell types the gene is expressed...scientists use plasmids? Generally, scientists use plasmids to manipulate gene expression in target cells...replication machinery proteins Antibiotic Resistance Gene Allows for selection of plasmid-containing bacteria...MCS is often downstream from a promoter. Insert Gene, promoter or other DNA fragment cloned into the ...obtained. Selectable Marker The antibiotic resistance gene allows for selection in bacteria. However, many ...referred to as “vectors” or “constructs.” To insert a gene of interest into a vector, scientists may utilize...

...CRISPR-Cas9 constructs from Addgene to gene-edit mutations into XP genes and other genes involved in photosensitivity...researchers identified the gene responsible for the disease as ATP1A3. The gene encodes a sodium-potassium...Syndrome, a devastating genetic disease caused by mutations in the OCRL1 gene that leads to the early ...studies on OCRL1 already underway in his lab. The gene appears to play a role in many cell processes involving... learned there was a disease associated with the gene, it piqued their interest. They obtained cells from... University with David Goldstein’s lab, will use GFP-ATP1A3, FLAG-ATP1A3, and ATP1B3 plasmids to explore...McSweeney says they now think that mutations in the gene may prevent neurons from returning to basal conditions...

...this plasmid with your gene of interest, you would replace mCherry with your gene of interest. pBLADEONLY...already have a pBAD33-based plasmid expressing your gene of interest, all you have to do is co-transform ...co-transform pBLADEONLY. That way, a previously cloned gene of interest, under the pBAD promoter, can be controlled...strain transformed with pBLADE expressing superfolder GFP instead of mCherry under the PBAD promoter. They ... Resources on Addgene.org Check out the Molecular Biology Reference Download Addgene's Plasmids 101 eBook...simply more precise. “We show that you have less heterogeneity in the population and you can do all of these...permission.   BLADE is just one of the several optogenetic tools that Di Ventura’s lab and Khammash's lab...

...reporter like GFP, some smaller CRISPR-Cas proteins such as SaCas9, CRISPR gRNAs, or your gene of interest...through this challenging sequence. Transgene The transgene is the gene that will be delivered by the AAV...expression of the AAV transgene. On a plasmid map, promoters are upstream or 5’ of the gene they control. Promoters...plasmid which contains the structural and packaging genes, the adenoviral helper plasmid which contains the...for the successful and specific expression of your gene of interest. References Haery L, Deverman BE, ...Terminal Repeats of Adeno-Associated Virus. Human Gene Therapy Methods 30:206–213 . https://doi.org/10.1089...control transgene expression. Lox sites are directional 34 bp sequences that can flank the transgene and ...

...repression of your target gene, activation and repression of different genes in a single cell, and localization...Favorite Fluorescent Protein Oligomerizes in Cells GFP oligomerization can lead to misleading artefacts ...replication and transcription as well as reporter genes. To learn how you can use minigenomes in your research... them in action. AAV: A Versatile Viral Tool for Gene Expression in Mammals Adeno-associated viruses (... (AAVs) are commonly used to deliver a genes of interest to a variety of cell types in-vivo. These are...localization of a fluorescent signal to your target gene. Read this post to find out more about how the Casilio...are widely used by the optogenetics and chemogenetics communities to activate neurons and neuronal pathways...

...applications used to study gene function. From making transgenic animals, gene targeting and genome modifications...These vectors allow you to test the function of Your Gene Of Interest (YGOI) in a controlled environment under...design. You can create a new strain with a disrupted gene by transforming wild-type yeast with an integrating...using a reporter vector to tag YGOI with lacZ and/or GFP (e.g. pPD80_08) and following the expression pattern...modifications to reporter vectors (e.g. pBV-Luc) and gene silencing (e.g. pLKO.1 - TRC cloning vector). Check...visualize YGOI in vivo (try pcDNA3-EGFP). If you can get away with generating transiently transfected cells... More Plasmid Resources from Addgene: Plasmids 101 blog series Addgene's Molecular Cloning Guide & Other...

...Versatile Tool for Gene Expression in Mammals Additional Resources on Addgene.org Overview of Viral ...pooled libraries. Whether you’d like to knockout a gene, replace it, modulate its expression, or perform...also have lentivirus for delivering control shRNAs, GFP, and rtTA from the Tet-on system. The first two can...while rtTA can be used to activate expression of a gene under the control of the tet operator. AAV AAVs ...associated virus (AAV, primarily chemogenetics tools for now but with optogenetic tools coming soon). The viral...excited that Addgene is now offering virion preparations to the scientific community. Addgene's AAV preparations...posts on the blog and pages on the Addgene website. blog.addgene.org The blog provides tips for working...

...in applying gene technology to bacteria and plants. Her research involves cloning cry genes from the soil...using a bacterial expression system such as the pET GFP LIC cloning vector and the pOKD plasmids. The recombinant... shared mission of both Seeding Labs and Addgene. The Addgene-Seeding Labs plasmid grant is a collaborative...of the Addgene-Seeding Labs Plasmid Grant awardees' projects progress. Subscribe to the Addgene blog for.... Additional Resources on the Addgene Blog Learn More About the Addgene-Seeding Labs Plasmid Grant Check...introduce the 5 scientists who were awarded the Addgene-Seeding Labs Plasmid grant this year. These scientists...plant biology, she coordinates the Network for the Genetic Improvement of Cowpea, a knowledge database for...

...James M. Wilson 37825-CAP-B10 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana...Viviana Gradinaru 37825-CAP-B22 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana... Gradinaru 37825-CAP-MaCPNS1 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana... Gradinaru 37825-CAP-MaCPNS2 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana...Tasic Melina Fan 221463-AAV1 pAAV_BiPVe4_eGFP AAV construct expressing eGFP driven by chandelier cell-targeting...enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell James M. Wilson 221463-PHPeB pAAV_BiPVe4_eGFP AAV construct...construct expressing eGFP driven by chandelier cell-targeting enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell...

...experiment. PITChing MMEJ as an Alternative Route for Gene Editing Michohomology-mediated end joining (MMEJ...PubMed Central PMCID: PMC5495063 Kan et al. use a GFP-BFP conversion system to assess precision genome ...template to increase efficiency of insertion and gene replacement. Care to share your favorite CRISPR ...Blugene and I represented Addgene at the recent Keystone meeting on Precision Genome Editing with Programmable...hopes to evaluate genome editing pipelines and generate a common lexicon for genome editing studies. These...desired edit, and I want to make sure that I (and Addgene) don’t forget this in the future. Here’s a list... to keep current with the latest and greatest! Addgene resources 3 Tips to Improve HDR Efficiency for ...

...endocytosis of a fluorescent dye and transduction of GFP-expressing AAV particles we did not observe any difference...during adeno-associated virus manufacturing." Human gene therapy21.10 (2010): 1251-1257. PMID: 20649475. ...have probably heard about Addgene’s viral service but did you know that Addgene also performs independent...101 eBook Additional resources on Addgene.org Learn about Addgene's viral service Learn about viral production...research? Since launching the viral service in 2016 Addgene’s research team has been actively investigating ...PMCID: PMC2957237. Additional resources of the Addgene blog Read our beginner's guide to viral vectors...

... (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used...Solubility Enhancer. In P. E. Vaillancourt, E. coli Gene Expression Protocols (Vol. 205, pp. 99–118). Humana...-59259-301-1:99 Resources on Addgene.org Addgene antibodies Addgene’s antibody guide Antibody protocols...having solubility issues!). Need a GST antibody? Addgene has you covered! His His tags, often called polyhistidine...Purification of His fusion proteins from E. coli is generally more straightforward and of a higher purity than...and other qualities of each tag class, they are generally best suited for their primary application. Ready...protocols  Resources on the Addgene blog Plasmids 101: Protein tags Antibodies 101: Epitope tags To Each...

...multiple) rAAV-CAG::FLEX-rev:: hM4D-2a-GFP AAV1 Chemogenetics Scott Sternson New viral prep pAAV-CaMKIIa-hM3D...mCherry AAV1 Chemogenetics Bryan Roth New serotype pAAV-CaMKIIa-hM4D(Gi)-mCherry AAV1 Chemogenetics Bryan ...mCherry AAV1 Chemogenetics Bryan Roth New serotype pAAV-hSyn-hM4D(Gi)-mCherry AAV1 Chemogenetics Bryan Roth...AAV-PHPeB Optogenetics Jonathan Ting New viral prep AiP14033: pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-...AAV-PHPeB Optogenetics Jonathan Ting New viral prep AiP14035: pAAV-AiE0452h_3xC2-minBG-CoChR-EGFP-WPRE3-...pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5140) AAV-PHPeB Optogenetics Jonathan Ting New viral... Brian O'Neill.  More resources on the Addgene blog Addgene's Data Hub What is a Virus (and a Viral Vector...

...highlighted back in 2015, where sdAbs were used to create GFP scaffolds for transcriptional activation.  sdAbs ...from addgene.org  Plasmids encoding nanobodies at Addgene Sybody Generation Toolbox from Addgene     ...only antibodies. (A) Overview of genetic modifications made to generate the nanomouse. (VHH = variable ...The UN General Assembly has declared 2024 the International Year of Camelids. The declaration is intended...to human populations around the world. Here at Addgene, we love camelids too, though not just for the ...chromobodies,” which are single-domain antibodies genetically fused to fluorescent proteins and used to visualize... synthetic single-domain antibody libraries to generate new sdAbs. There has also been some interesting...

... Fig. 3: Image of Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from ...C-terminal region of the human proto-oncogene c-Myc. Since the generation of the first anti-c-Myc [9E10] (...high-throughput screening platform to apply saturating mutagenesis on 21 positions in the protein sequence of the...approach and outcomes of the screen for improved genetically-encoded voltage indicators (GEVIs) based on the...kinetics. They demonstrate the use of HcKCR1 as an optogenetic silencer in experiments with mouse cortical neurons... HcKCR2, making it more suitable for in vivo optogenetic use.   Fig. 2: A) HcKCR1 is highly selective...control K+ gradients and can be used as a potent optogenetic silencer. The current work also proposes promising...

...contains circularly permuted green fluorescent protein (GFP), and nLightR uses a red fluorescent protein, mApple...Imaging Tools Resources on Addgene.org Find Biosensor Plasmids Find Optogenetics Plasmids Visit the Fluorescent... visualize their activity. In 2019, the first generation of norepinephrine sensors was developed, named...norepinephrine (Feng et al., 2019). But this first generation of tools had limited sensitivity and speed and... models of nLightG (left) and nLightR (right) generated using ColabFold (Mirdita et al., 2022). B, Representative...Speed One of the major advantages of this next generation of norepinephrine sensors is their speed. nLightG...GRABNE were more sensitive than nLightR, both generating a measurable signal after electrical stimulation...

...-length mouse HAPLN1 fused with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev...lectican binding domain and fused with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...dependent manner. 1 Don Arnold 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Thomas Jessell , Eiman Azim...Long Overexpression Tools These AAV encode various genes for overexpression. ID Name Expression System Activity... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a. 5, rg*...

...targeting a gene associated with diphtheria toxin lethality and were sorted into single wells to generate clonal...instance, it’s much more difficult to introduce a gene of interest into primary cells, so most primary ...Neuronal stem cells transduced with iTOP resulting in GFP expression. Image courtesy of Diego D'Astolfo. ... risk of viral integration causing mutations and gene expression changes elsewhere in the genome. Second...j.cell.2015.03.028. PubMed. Find the Plasmids @Addgene: iTOP-tested proteins and reporters Previous...

...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...for the incorporation of phosphoserine into your gene of interest. Depositor...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid...phosphoserine into the growing polypeptide chain to generate the new phosphorylated protein. Protein Phosphorylation...by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al., 2011). Follow up ...further details in Mohler et al. (2023) and find general tips on phosphoprotein expression in rEcoli XpS...

...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...include: EGFP-expressing AAV for serotype testing Calcium sensors and GABA sensors Optogenetics Recombinases... pAAV.hSynap.iGABASnFR (112159-AAV1) Optogenetics Optogenetics continues to be a useful method for manipulating...viral vectors 101 eBook Resources on Addgene.org Learn about Addgene's viral service Find viral protocols... testing AAV, which are small (20 ul) samples of EGFP-expressing AAV packaged in various serotypes. This...recently released these controls: pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad...broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE (51502-AAV5): The CAG promoter directs ubiquitous expression...

...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...and regulatory genes; one plasmid in second-generation, two plasmids in third-generation Envelope plasmid...contains packaging gene env This collection highlights popular second- and third-generation lentiviral packaging...hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA...promoter for transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP reporter....24129 pULTRA 3rd Bicistronic expression of EGFP and the gene of interest. Can also express shRNA (cloning...Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin...

...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...sequence between two target sites. Modifying multiple genes at once. Using multiplexed gRNAs can target multiple...simultaneous multiplex editing of six different genes. This system doesn’t rely on any additional or host-dependent...from this paper at Addgene. 9. Yin, Linlin, et al. “Multiplex Conditional Mutagenesis Using Transgenic ...plasmids from this paper at Addgene. Additional Resources on the Addgene Blog Browse Our CRISPR Topic...add multiple gRNAs on one plasmid. Sound good? Addgene has many tools to help you multiplex - we’ll use...multiplex gRNAs, some being: Using dual nickases to generate a knockout or edit. This can help reduce off-target...

... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, or both...Karl Deisseroth (Addgene viral prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from... plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral helper sequences...viral vectors are tested in vitro and in vivo for gene expression and/or function. These data are sometimes...copies of the lentiviral Rev responsive element (RRE) gene and the cellular ribonuclease P/MRP 30 kDa subunit...Production AAV distributed by Addgene has been produced either in-house by Addgene scientists or through collaboration...

...plasmids from this publication at Addgene. Multichromatic control of gene expression in Escherichia coli...optimized by Tabor’s lab, making light-controlled gene expression in E. coli easier and more robust. Synthetic...used to engineer new pathways with sophisticated gene expression controls. Most cell types do not respond... can be coexpressed for sophisticated control of gene expression. An E. coli light-sensitive two-component...via phosphorylation, promoting transcription of a GFP reporter. Subsequent exposure to red light rapidly... was only about 10-fold, precluding the study of gene expression at very high or very low levels. Schmidl...researchers to better fine-tune the level of output gene expression based on the input light intensity. In...

...test for your gene of interest may be another method to assess transfection success. GFP is often used...lines and are not used for general plasmid selection. Instead, reporter genes are often employed to easily...conjunction with positive selection to ensure your gene gets targeted to a specific location within the ...used selection markers are listed below: Name Gene Conferring Resistance Cell Types* Mode of Action...use G418. This can be confusing since the neo/kan gene confers G418 resistance; however, like gentamicin...Read More: Plasmids 101: Antibiotic Resistance Genes Plasmids 101: Origin of Replication All Plasmids...the genetic traits of the foreign material and will subsequently pass it on to future generations. Stably...

... for gene expression, turning transcription on and off by binding proximal to their target genes. Since...Since gene expression patterns determine everything from stem cell differentiation fate to tumor suppression...library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order...from the library to further investigate specific genes and TF isoforms. Due to the size of the collection...use to generate the relevant disease model. Accurate modeling of a disease depends on both genetic and expression... not yet available, just ask an Addgene scientist at help@addgene.org! References and Resources  References...scientific community. Recently, the Zhang lab generated a TF library (aka the MORF Collection) and an ...

...that control cell cycle gene expression.  Additional Resources on the Addgene Blog Visit the fluorescent...page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org Find fluorescent protein...work in Lin Tian’s lab at UC Davis is to generate a genetically encoded fluorescent sensor for serotonin...sequence an individual’s genome. But when they find genetic variants, what does that mean? Previous research...of Washington sought to address the effects of genetic variants in a high throughput manner. She helped...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...

... also includes a GFP construct as a control. For easier portability, all viral genes are flanked by EcoRI...coronavirus or COVID-19 research, please email Addgene at help@addgene.org with your order number and so it can .... Sign up for email alerts on the Krogan lab's Addgene page to get notified!) Attacking coronavirus, one...reasons, the QCRG is delighted to be partnering with Addgene, who will be taking over the distribution to expand... coronavirus related plasmids and resources at Addgene* Many thanks to our guest bloggers Manon Eckhardt...

...developed four acoustic reporter gene (ARG) plasmids to better monitor gene expression in vivo using ultrasound...non-immunogenic violet-excited GFP variant Vex. To understand the impact of this gene editing tool on the immune...plasmids at Addgene. Liu Q et al., Neuron. 2019. PubMed PMID: 30704911. Acoustic reporter genes for noninvasive...by Lukas Morgan  Listen to the acoustic reporter gene podcast segment In recent years, scientists are ...through a host organism, the expression of some genes can change depending on the location. Current methods...of microbes rely heavily on fluorescent protein genes. These optical reporters have limited deep-tissue...ultrasound. These ARG plasmids contain genes for “gas vesicles,” a gas-filled protein structure that water-bound...

...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...

...They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any additional tips,...homology arm as a gBlocks® Gene Fragment from Integrated DNA technologies. Generally speaking, anyone using... an effort to track down every last one of those gene regulatory proteins and the places in the genome...together on several projects and this is one related to gene expression. One goal of the ENCODE project is to...with detailed protocols, go to www.addgene.org/crispr/tagging. Addgene: What motivated you to adapt CRISPR...tagging system, which they’ve now made available at Addgene. For more details on the plasmids that are currently...can now look at many more transcription factors. Addgene: How does the system work? Mendenhall: The system...

...Utilization During Gene Targeting with Zinc-Finger Nucleases. G3 Genes Genomes Genetics, 3(4), 657–664. ...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...Jaenisch, R. (2013). One-Step generation of mice carrying mutations in multiple genes by CRISPR/CAS-Mediated ...example, choosing target sites that span the knock-in gene. For making mutations, one good way is to mutate...be okay if you are introducing a selection marker gene. The homology arms should be no more than 100 bp...for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper ...Winderbaum, J., Nickoloff, J. A., & Jasin, M. (1998). Gene Conversion Tracts from Double-Strand Break Repair...

...into contact with than GFP. Similarly, if the viral vector carries an shRNA to a gene essential for cellular...looks like the genetic cargo in one plasmid (the transfer plasmid), the envelope (Env) gene on a separate...with those particles. Since the Env, Gag, and Pol genes are not encoded in the transfer plasmid, the component...Resources Resources on Addgene.org Addgene viral services Addgene Biosafety Guide Addgene Viral Plasmids ...? That’s okay! In this article we will discuss general viral safety considerations and best practices ...of what is being integrated by the virus. If an oncogene overexpression construct is being delivered, that... and the same holds true for types of viruses generated in the lab. The four most common types of viruses...

...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for... 37825-AAVrg.T 20 µL $ 158 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

...ones? Many of the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free...Resources on Addgene.org Addgene’s AAV Guide Fluorescent Proteins: Biosensors Addgene’s Viral Services...calcium sensors. Selecting a calcium sensor Genetically encoded calcium indicators (GECIs) are fluorescent...neuronal cell body or the axon (GCaMP6 only). The genetic elements required for Drosophila studies have been...chemical biology. 2021 May;17(5):509-18. Inoue M. Genetically encoded calcium indicators to probe complex brain...Aug 1;169:2-8. Suzuki J, Kanemaru K, Iino M. Genetically encoded fluorescent indicators for organellar...SA, Looger LL. Imaging neuronal activity with genetically encoded calcium indicators. Cold Spring Harbor...

...line, Hep3B. From left to right: Mitotracker Red, GFP for the biosensor, Hoechst, and overlay).   ...(DKFZ) who has developed new redox sensitive GFP2 (roGFP2)-based biosensors for live cells. His work focuses..., Pedre Pérez’s biosensor fuses MPST to roGFP2. Because roGFP2 contains two cysteines near the chromophore...developed a dual virus system using both optogenetics and chemogenetics to study the activity of parvalbumin...in the lab. He has recently developed a third-generation intensiometric glutamate sensing fluorescent ...catalyzes the desulfuration of 3-mercaptopyruvate and generates an enzyme-bound hydropersulfide that is then transferred...the MPST hydrosulfide can be transferred to the roGFP2 cysteine thiols and change its fluorescence properties...

...Cre-lox Control Protein Activity with GFP Resources at Addgene.org Find KTR reporter plasmids Find photoactivatable...spatiotemporal resolution than pharmacological or genetic approaches, but only a few such methods exist and...Solution: In Zhou et al, the Lin lab present a generic design for creating photoswitchable kinases and...possible to create other photoswitchable kinases? The general design of psMEK1 also worked for creating three...PMCID: PMC4097317. Additional Resources on the Addgene Blog Learn More about Photoactivatable Fluorescent...

...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse ...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC Reverse...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP...

...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ... information, please visit the Addgene SAM library page . Targeted gene activation using SAM There are...available for mammalian endogenous gene activation using SAM: Addgene plasmids #61422 - #61424 were designed...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically...human codon-optimized, and packages both the SaCas9 gene and its single guide RNA (sgRNA) into one plasmid...