We narrowed to 81 results for: Alb

1. Tips for Getting a Faculty Position

   Type

   Blog Post

   ...Institutes of Health, was an Associate Professor at Albert Einstein College of Medicine in the Department ...

2. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

   Type

   Blog Post

   ...450.7166 (2007): 56. PubMed PMID: 17972876. Pan, Y. Albert, et al. "Multicolor Brainbow imaging in zebrafish...

3. Plasmids 101: Biotinylation

   Type

   Blog Post

   ...Buoyancy-Activated Cell Sorting Using Targeted Biotinylated Albumin Microbubbles.” PLoS ONE 10.5 (2015). PubMed PMID...

4. Site Directed Mutagenesis by PCR

   Type

   Blog Post

   ...potentially introduced anywhere in the plasmid (albeit at extremely low frequency), and these could interfere...

5. Thoughts on the Future of Research 2015 Boston Symposium

   Type

   Blog Post

   ...speakers Moon Duchin, Rafael Luna, Joan Reede, Alberto Roca, and Jessica Tytell made it was obvious that...

6. Plasmids 101: Dimers and Multimers

   Type

   Blog Post

   ... M, Strausbaugh LD, Gray P, Vartak NB, Brown M, Talbot D, Berg DE. pBR322-derived multicopy plasmids harboring...

7. Plasmids 101: Repressible Promoters

   Type

   Blog Post

   ... publication at Addgene. del Valle Rodriguez, Alberto, Dominic Didiano & Claude Desplan. “Power tools...

8. CRISPR 101: Epigenetics and Editing the Epigenome

   Type

   Blog Post

   ...restore the DNA after cytosine removal. Recently, Albert Cheng’s lab developed Casilio-ME, which is based...

9. Antibodies 101: The Basics of Western Blotting

   Type

   Blog Post

   ... a buffer containing nonfat milk, bovine serum albumin or other proteins. The sticky areas on the membrane...

10. Deisseroth INTRSECT Collection

    Type

    Collection

    ... 2019. Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex...

11. A History of Genome Engineering in Popular Culture

    Type

    Blog Post

    ...the movie involves The Rock and his super giant albino gorilla fighting off a monstrous wolf and crocodile...

12. Plasmids 101: Using Transposons in the Lab

    Type

    Blog Post

    ...insertion into the fish’s tyrosinase gene caused albinism (Koga et al., 1996). Unlike Sleeping Beauty and...

13. A Guide to Getting Started in Undergrad Research

    Type

    Blog Post

    ...word “scientist” conjured up images of men like Albert Einstein and Bill Nye in their lab coats handling...

14. 9 tips for a successful postdoctoral experience

    Type

    Blog Post

    ...Institutes of Health, was an Associate Professor at Albert Einstein College of Medicine in the Department ...

15. Special Delivery: Fluorophore Targeting for FRET Studies

    Type

    Blog Post

    ...): e7338. PubMed PMID: 19823671. 5. Griffin, B. Albert, Stephen R. Adams, and Roger Y. Tsien. "Specific...

16. CRISPR 101: Multiplex Expression of gRNAs

    Type

    Blog Post

    ... Find plasmids from this paper at Addgene. 4. Albers, Joachim, et al. “A versatile modular vector system...

17. CRISPR Pooled gRNA Libraries

    Type

    Collection

    ...Mouse Pu N/A 6 14,671 Pan-cancer CasRx lncRNA Albarossa Library 212966 Knockout Human Rad 3rd Varies 156,250...

18. Validated gRNA Sequences

    Type

    Collection

    ...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S...

19. Using AAV for Neuronal Tracing

    Type

    Blog Post

    ...are used. For predominantly retrograde tracing, albumin protein labelled with horseradish peroxidase (HRP...

20. 27 Hot Plasmids from 2016

    Type

    Blog Post

    .... Parton DL, Hanson SM, Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM...