We narrowed to 81 results for: Alb
-
TypeBlog Post...Institutes of Health, was an Associate Professor at Albert Einstein College of Medicine in the Department ...
-
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...450.7166 (2007): 56. PubMed PMID: 17972876. Pan, Y. Albert, et al. "Multicolor Brainbow imaging in zebrafish... -
Plasmids 101: Biotinylation
TypeBlog Post...Buoyancy-Activated Cell Sorting Using Targeted Biotinylated Albumin Microbubbles.” PLoS ONE 10.5 (2015). PubMed PMID... -
Site Directed Mutagenesis by PCR
TypeBlog Post...potentially introduced anywhere in the plasmid (albeit at extremely low frequency), and these could interfere... -
Thoughts on the Future of Research 2015 Boston Symposium
TypeBlog Post...speakers Moon Duchin, Rafael Luna, Joan Reede, Alberto Roca, and Jessica Tytell made it was obvious that... -
Plasmids 101: Dimers and Multimers
TypeBlog Post... M, Strausbaugh LD, Gray P, Vartak NB, Brown M, Talbot D, Berg DE. pBR322-derived multicopy plasmids harboring... -
Plasmids 101: Repressible Promoters
TypeBlog Post... publication at Addgene. del Valle Rodriguez, Alberto, Dominic Didiano & Claude Desplan. “Power tools... -
CRISPR 101: Epigenetics and Editing the Epigenome
TypeBlog Post...restore the DNA after cytosine removal. Recently, Albert Cheng’s lab developed Casilio-ME, which is based... -
Antibodies 101: The Basics of Western Blotting
TypeBlog Post... a buffer containing nonfat milk, bovine serum albumin or other proteins. The sticky areas on the membrane... -
Deisseroth INTRSECT Collection
TypeCollection... 2019. Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex... -
A History of Genome Engineering in Popular Culture
TypeBlog Post...the movie involves The Rock and his super giant albino gorilla fighting off a monstrous wolf and crocodile... -
Plasmids 101: Using Transposons in the Lab
TypeBlog Post...insertion into the fish’s tyrosinase gene caused albinism (Koga et al., 1996). Unlike Sleeping Beauty and... -
A Guide to Getting Started in Undergrad Research
TypeBlog Post...word “scientist” conjured up images of men like Albert Einstein and Bill Nye in their lab coats handling... -
9 tips for a successful postdoctoral experience
TypeBlog Post...Institutes of Health, was an Associate Professor at Albert Einstein College of Medicine in the Department ... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...): e7338. PubMed PMID: 19823671. 5. Griffin, B. Albert, Stephen R. Adams, and Roger Y. Tsien. "Specific... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post... Find plasmids from this paper at Addgene. 4. Albers, Joachim, et al. “A versatile modular vector system... -
CRISPR Pooled gRNA Libraries
TypeCollection...Mouse Pu N/A 6 14,671 Pan-cancer CasRx lncRNA Albarossa Library 212966 Knockout Human Rad 3rd Varies 156,250... -
Validated gRNA Sequences
TypeCollection...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S... -
Using AAV for Neuronal Tracing
TypeBlog Post...are used. For predominantly retrograde tracing, albumin protein labelled with horseradish peroxidase (HRP... -
27 Hot Plasmids from 2016
TypeBlog Post.... Parton DL, Hanson SM, Rodríguez-Laureano L, Albanese SK, Gradia S, Jeans C, Seeliger MA, Levinson NM...