Skip to main content

We narrowed to 11 results for: Alb

Showing: 1 - 11 of 11 results
  1. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Anti-Calbindin [L109/39R] Calbindin Human Mouse IgG2a 177455 Anti-Calbindin [L109/57R] Calbindin Human...Anti-Parvalbumin [L114/3R] Parvalbumin Rat Mouse IgG2a 177460 Parvalbumin [L114/81R] Parvalbumin Rat Mouse...Human Mouse IgG2b 206635 Anti-CALB1/calbindin [L109/39R-2b] CALB1/calbindin Human Mouse IgG2b 206636 Anti-Homer1L...Human Mouse IgG1 206686 Anti-CALB1/calbindin [L109/39R-1] CALB1/calbindin Human Mouse IgG1 206687 Anti-Homer1L...206641 Anti-CALB2/calretinin [L122/68R-2b] CALB2/calretinin Human Mouse IgG2b 206642 Anti-CALB2/calretinin...206690 Anti-CALB2/calretinin [L122/68R-1] CALB2/calretinin Human Mouse IgG2a 206691 Anti-CALB2/calretinin... Mouse 182071 Calbindin scFv [L109/57] L109/57 Calbindin Human Mouse 182072 Parvalbumin scFv [L114/3] ...
  2. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...AiE0140h-minRho-SYFP2-WPRE3-BGHpA AiP11633 AiE0140h SYFP2 Pvalb interneurons Isocortex 230382 pAAV-AiE0140h-minBG-iCre...pAAV-AiE0140h-minBG-iCre(R297T)-BGHpA AiP13786 AiE0140h Cre Pvalb interneurons Isocortex 230099 pAAV-hsA2-AiE0086m-minRho-SYFP2...AiE0086m-minRho-SYFP2-WPRE3-BGHpA AiP11580 AiE0086m SYFP2 Pvalb interneurons Isocortex 230807 pAAV-hsA2-AiE0086m-minRho-iCre...-minRho-iCre(R297T)-BGHpA AiP20171 AiE0086m Cre Pvalb interneurons Isocortex 229885 pAAV-AiE0475m-minBG-SYFP2...BGHpA AiP12320 AiE0475m SYFP2 Chandelier cells (Pvalb) Isocortex 230384* pAAV-AiE0475m-minBG-iCre(R297T...)-BGHpA AiP13790 AiE0475m Cre Chandelier cells (Pvalb) Isocortex 214561 pAAV-AiE2566m-minBG-SYFP2-WPRE3...10aa-H2B-WPRE3-BGHpA AiP15043 AiE1419m SYFP2 Pvalb_Pthlh interneurons Striatum 224199 pAAV-AiE1419m-minBG-iCre...
  3. Ras Pathway

    Type
    Collection
    ...proto-oncogene RAL RALA RALB v-ral simian leukemia viral oncogene homolog (ras related) RALBP1 RalA binding protein...downstream targets. Rajalingam K, Schreck R, Rapp UR, Albert S. Biochim Biophys Acta. 2007 Aug;1773(8):1177-...
  4. Brain Armamentarium

    Type
    Collection
    ...fluorescent protein) in striatal Pvalb+ neurons. Note strong cortical Pvalb and L5 ET neuron expression. ...
  5. Luciferase Plasmid Collection

    Type
    Collection
    ... plants using Gateway cloning. Use with 174051 Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal... plants using Gateway cloning. Use with 174050 Alberto Macho 136010 psi-CHECK3 Firefly, Renilla Insertion...
  6. Mammalian RNAi Tools

    Type
    Collection
    ...PubMed (Link opens in a new window) . Dana, H., Chalbatani, G. M., Mahmoodzadeh, H., Karimloo, R., Rezaiean...
  7. Zebrafish Plasmid Collection

    Type
    Collection
    ... for cell tracing - Sean Megason Lab Zebrabow - Albert Pan and Alex Schier Labs. Multicolor fluorescent...
  8. Deisseroth INTRSECT Collection

    Type
    Collection
    ... 2019. Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex...
  9. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Mouse Pu N/A 6 14,671 Pan-cancer CasRx lncRNA Albarossa Library 212966 Knockout Human Rad 3rd Varies 156,250...
  10. Validated gRNA Sequences

    Type
    Collection
    ...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S...
  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... pRS-45 TBP His, yTAND12 T7 Parkinson's Harald Schwalbe 40822 EGFP-alphasynuclein-WT SNCA GFP CMV Parkinson's... SETX Flag, GFP CMV ALS, Ataxia with neuropathy Albert La Spada 219442 Anti-Kv1.1 K+ channel [K20/77R]...
Showing: 1 - 11 of 11 results