Skip to main content

We narrowed to 81 results for: KAN;

Showing: 61 - 80 of 81 results
  1. CRISPR Plasmids - Tagging

    Type
    Collection
    ... CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato Kanemaki's lab has developed a ...
  2. Typing CRISPR Systems

    Type
    Blog Post
    ...https://doi.org/10.1038/nature24049 Altae-Tran, H., Kannan, S., Suberski, A. J., Mears, K. S., Demircioglu...
  3. Validated gRNA Sequences

    Type
    Collection
    ...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S....
  4. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9...
  5. Fluorescent Proteins: FRET

    Type
    Collection
    ...128,000 0.45 6.4 4.9 pNCS-mClover3 , pNCS-mRuby3 , pKanCMV-mClover3-mRuby3 mNeonGreen mRuby3 506 0.80 592 ...
  6. Rett Syndrome

    Type
    Collection
    ... (Link opens in a new window) PMID: 6638958 Kankirawatana et al. 2006. Early progressive encephalopathy...
  7. Deisseroth INTRSECT Collection

    Type
    Collection
    ...AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission...
  8. Tetracycline Inducible Expression

    Type
    Collection
    ...conditional auxin-inducible degron system Masato Kanemaki 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep Tet-inducible...
  9. Molecular Biology Reference

    Type
    Guide
    ...Ethanol) 25 µg/mL Hygromycin B 200 mg/mL 200 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...
Showing: 61 - 80 of 81 results