Skip to main content

We narrowed to 82 results for: c myc plasmid

Showing: 61 - 80 of 82 results
  1. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene has used a number of primers...useful in your sequencing reaction, find your plasmid’s page and see what primers are listed under "5'...questions about choosing the best primer for your plasmid? Email us at [email protected] . For additional ...additional information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular ...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT 5' end of...CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N...
  2. Droplet Digital PCR for AAV Quantitation

    Type
    Blog Post
    ...calculate the viral titer: GC/mL = {[(R*C)(1000/V)]*D} R = Reaction volume C = Copies/uL V = Volume of virus ...get right. Here at Addgene, we use a linearized plasmid standard. However, even when the standard is made...Song, Neng, et al. "Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital...
  3. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ...curated collections of plasmids as kits with greatly reduced costs per plasmid. We generally create kits...just the tool you need. The plasmids in this portion of the BIOFAB Plasmid Set contain terminators of ...populations. This kit consists of a 48 plasmid adapter library, with each plasmid carrying a unique barcoded Illumina-M13F...generate N- and C-terminal epitope tag fusions to a protein of interest. The plasmids used to generate...researcher at a nonprofit institution, you can order plasmids covering a wide range of fields from Addgene. ...kits to allow you to easily use a set of plasmids together on a tight budget. To help popularize our ...order from the repository: FX Cloning Kit BIOFAB Plasmid Set pCri System Cell Free Protein Expression Kit...
  4. Viral Production

    Type
    Collection
    ...the transfer plasmid, a plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral... coli . In addition, plasmids are typically prepared using endotoxin-free plasmid purification kits. Resources...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...contamination is minimized by using an endotoxin-free plasmid purification protocol. To minimize the immunogenic...off-line and discarded. Confirmation of Transfer Plasmid Addgene uses a rigorous barcode matching system...microbial contamination. Purity When possible, all plasmids used for viral production are propagated in the...experiment using our virus protocols . Browse our plasmid collection of popular lentiviral vectors ....
  5. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing oligos C.3 Digesting...μg pLKO.1 shRNA plasmid 750 ng psPAX2 packaging plasmid 250 ng pMD2.G envelope plasmid to 20 μl serum-...to vary the ratio of shRNA plasmid, packaging plasmid, and envelope plasmid to obtain the ratio that gives...Virus may be stored at 4°C for a few days, but should be frozen at -20°C or -80°C for long-term storage....shRNA. psPAX2 Packaging plasmid for producing viral particles. pMD2.G Envelope plasmid for producing viral... also be used with packaging plasmid pCMV-dR8.2 dvpr and envelope plasmid pCMV-VSVG from Robert Weinberg... vector, producing a final plasmid that expresses the shRNA of interest. C.1 Recommended Materials Material...
  6. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...plans and in particular, that they all share the plasmids created under this programs via Addgene. New organisms...sexual reproductive life cycles. One can inject plasmid DNA in the eggs to get transgenic animals. They...habitats - even 50 meters from Old Faithful in 60 °C soils. Dendrobatidae (Lauren O’Connell)  Poison frogs...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...
  7. Plasmids 101: Modular Cloning Applications and Kits

    Type
    Blog Post
    ...between CRISPR components expressed from different plasmid backbones. They noted that backbone differences... as the order, or distance in the placement of plasmid elements can impact expression levels and consequently...system was used to assess how different lentiviral plasmid backbone elements impact viral titer and to compare...plants, and animals (Chiasson et al., 2019). Many plasmid elements such as promoters or fluorophores are ...Collection More resources on the Addgene blog Plasmids 101: Golden Gate Cloning High Complexity Golden...doi.org/10.1371/journal.pone.0197185. Chamness, James C., et al. “An Extensible Vector Toolkit and Parts Library...Toolkit for Extensive and Flexible Engineering of Saccharomyces Cerevisiae.” ACS Synthetic Biology, vol. 12,...
  8. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...researcher can flank fluorescent proteins in a plasmid with loxP sites such that their expression is turned...Check out Our Fluorescent Protein Guide Pages Find Plasmids for Subcellular Localization Find Fluorescent ...system and its dynamics. References 1. Peters, Nathan C., et al. "In vivo imaging reveals an essential role...during the development and disintegration of mycobacterial granulomas." Immunity 28.2 (2008): 271-284. ...presentation and T cell effector function in mycobacterial granulomas." Immunity 34.5 (2011): 807-819. ...
  9. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...copy regardless of plasmid size. See the plasmid's info page to determine if your plasmid is high or low ... 37 °C for 12–18 h in a shaking incubator. Note: Some plasmids or strains require growth at 30 °C. If ...resistance gene on a plasmid allows researchers to easily isolate bacteria containing that plasmid from bacteria...isolate your plasmid DNA from the bacterial culture by following the Isolating Your Plasmid DNA protocol... low copy plasmids? The copy number refers to the number of copies of an individual plasmid within a single...number plasmids should only need to be grown for 12–16 h on average. Certain features of a plasmid may render...Glycerol Stocks for Long-term Storage of Plasmids Recovering Plasmid DNA from Bacterial Culture All Addgene...
  10. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...posts , or find CRISPR plasmids for your research. Addgene has CRISPR plasmids for the following models... in the field, and enabling access to multiple plasmids used for various platform applications. For more... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...
  11. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Site-Specific Recombinases Cre Plasmids Flp Plasmids Dre Plasmids Other Recombinase Plasmids Recombinase-Dependent...for "split", "rapamycin", “tamoxifen”, or “light”): Cre Recombinase Plasmids ID Plasmid Description Vector... vectors. Highlighted Plasmids Browse the tables below to find popular plasmids expressing your favorite... with GFP Plasmids 101: FLEx Vectors Optimizing AAV DIO and FLEx Vector Expression Plasmids 101: Knockout... Flp Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources ...Neuroscientist’s View Return to top Dre Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional...Return to top Other Site-Specific Recombinase Plasmids ID Plasmid Description Gene/Insert Vector Type Promoter...
  12. Control AAV Preps

    Type
    Collection
    ...Constitutive 5 Edward Boyden 59133 pOTTC589 - pAAV c-fos Nuc-eYFP c-Fos EYFP Constitutive 1 Brandon Harvey 59462...We provide high quality AAV preps from select plasmids in the repository. Browse our control AAV collection...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... 8 Karl Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ...
  13. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication FP Overexpression Plasmids for constitutive...Addgene Plasmids Bas Teusink Lab Materials Kurt Thorn Lab Materials Fluorescent Protein Plasmids & Resources...Find plasmids to overexpress various fluorescent markers and tag your proteins of interest with fluorescent...codon-optimized fluorescent proteins (FPs) in a variety of plasmids allows for constitutive overexpression of FPs ...proteins. These vectors are based on the pFA6a-link plasmid (Sheff et al., 2004; Lee et al., 2013), and are...codon-optimized FPs in yeast. Vectors are based on the pDRF1 plasmid (Loqué et al., 2007) containing the PMA1 promoter...promoter and the URA3 marker, the p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2...
  14. Molecular Biology Reference

    Type
    Guide
    ...Nucleobase B C, G, or T D A, G, or T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A,... Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified viral genomes...Recombinant DNA Working with Plasmids Plasmid Elements Types of Plasmids Molecular Cloning Common E. coli...coined the term plasmid, in reference to any extrachromosomal heritable determinant. Plasmids are fragments...elements using specifically engineered plasmids. These plasmids have become possibly the most ubiquitous... constructed a plasmid, you can easily make an endless number of copies of the plasmid using bacteria,...small RNAs, and other genetic elements. Plasmid Elements Plasmids come in many sizes and vary broadly in...
  15. mTOR Pathway

    Type
    Collection
    ...proliferation. mTOR Pathway Plasmids Click on a name to find available plasmids for the gene, or browse the...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Pathway Plasmids mTOR Gene List Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) ...Addgene's plasmids for the mTOR pathway. enhanced signaling of mTOR, a key metabolic regulator, correlates... - Gene List Click on a name to find available plasmids for the gene. For components with multiple isoforms...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...
  16. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...download from each plasmid page. Use the search bar or sort buttons to find plasmids based on: Organism...His-tags are cloned at the C-terminus of MDH and, if indicated on the plasmid map, a TEV cleavage site ...collaborations between institutions. With these plasmids, faculty can begin a sustainable MDH-related CURE...and metabolic pathways and protein interactions. Plasmids A diverse set of wild-type MDH genes from several..."active site loop", or "subunit interface") ID Plasmid Description Gene/Insert Mutations Additional Resources...opens in a new window) Acknowledgments The MCC and plasmid construction was funded by NSF IUSE 1726932 and...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic...
  17. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...collection of SARS-CoV-2 spike plasmids, packaging plasmids, and reporter plasmids for viral pseudotyping with...Accessory Plasmids Envelope and Packaging Plasmids Popular Lentiviral Envelope and Packaging Plasmids Popular...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for...2 Pseudotyped Virus SARS-CoV-2 Spike Plasmids Accessory Plasmids Other Resources Mechanisms of SARS-CoV...particles See Addgene's Viral Plasmids and Resources page for more information. Plasmids Expressing Spike and ...COVID-19 and Coronavirus Plasmids & Resources Ginkgo Bioworks COVID-19 Plasmid Collection Return to top...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...
  18. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene...selectable marker, and whether the plasmid contains Cas9. ID Plasmid Expression System Promoter Guide RNA...selection of CRISPR plasmids and resources. Find more CRISPR functions along with plasmids categorized by ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...prime editor plasmids for (search and replace) genome editing. CRISPR... CRISPR Prime Edit CRISPR Plasmids: Prime Edit...CRISPR topics, read our CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...
  19. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid #52962 ) and is described in Improved vectors and...heat-inactivated FBS and 5mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and FBS lots can promote...it can be inactivated in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health...dose of antibiotic, which may not be stable at 37 °C. To achieve a stable cell pool, the antibiotic selection...well plate and left undisturbed for 13 days. (a, b, c) Colonies formed by expansion of single cells for ...deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin), which enables selection of a stable...preparation Appropriate antibiotic for selection (e.g. puromycin, blasticidin) Reagent Preparation DMEM Complete...
  20. CRISPR References and Information

    Type
    Collection
    ...Addgene CRISPR Resources CRISPR Plasmids Addgene's collection of CRISPR plasmids. CRISPR Guide Addgene's guide...guide to using CRISPR plasmids in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's...barcoding. CRISPR Kits Addgene's collection of CRISPR plasmid kits. CRISPR Software Sanger Indel Analysis ICE... Feng Zhang Lab . Protocols Lab(s) Description Plasmids in protocol Download protocol Addgene CRISPR pooled...gRNA design and cloning for Cas9 orthologs Cas9 plasmids PDF, 107 KB Chen and Wente Zebrafish: gRNA cloning... (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid summary for transcriptional activation dCas9 activators... proteins pFETCh_Donor ; additional HDR & gRNA plasmids are available for CREB1, ATF1, GABPA, and RAD21...
Showing: 61 - 80 of 82 results