...chapters on genome engineering, cloning, and plasmid tags, addtional content added to the "Plasmids that Glow...resistant plasmid, pSC101, and a newly developed kanamycin resistant plasmid, pSC102, with EcoRI and selected...

...the concentration of inducer or adding an affinity tag such as GST may help with solubility issues. We ...toxic or insoluble proteins Origami2 (DE3)** Streptomycin and Tetracycline Contains highly active thioredoxin... General protein expression  m15 pREP4*, ** Kanamycin (pREP4) Cis-repression of the E. coli T5 promoter...

...uracil DNA glycosylase inhibitor and degradation tag on the fusion protein to limit the activity of the...other advantages including shorter plasmid curing time. pCRISPomyces for editing in Streptomyces  Streptomyces...created two “pCRISPomyces” systems for use in Streptomyces (Cobb et al., 2015). pCRISPomyces-1 includes ...array, while pCRISPomyces-2 contains Cas9 and a gRNA cassette. The simpler system of pCRISPomyces-2 displays...for transcriptional silencing Mycobacterium tuberculosis and Mycobacterium smegmatis. In addition to their...Addgene depositor Luciano Marraffini’s lab took advantage of this lethality to design the first synthetic...carries a spacer targeting the gene of interest and kanamycin resistance E. coli carrying the phage recombineering...

...elements – promoters, origins of replication, protein tags, and antibiotic resistance markers (just to name...recombination at the loxP recognition sites. A key advantage of the system is that Cre acts independently of...in certain cell or tissue types, during certain stages of development, or by making the Cre inducible ...recombination event in a single system. The Saccharomyces cerevisiae FLP-FRT recombination system is another...

...the the developing zebrafish pancreas. They first tagged these cells using plasmids. Then using HOTcre, ...researchers: the mouse (Mus musculus). Mice have many advantages as a mammalian model organism for scientists ...You can find these plasmids at Addgene. Another advantage of mice as model organisms is that they are genetically...in the fly (Pandey and Nichols, 2011). A huge advantage of using the fruit fly is the array of genetic... of the fly (Pfeiffer et al., 2010). Yeast (Saccharomyces cerevisiae) Yeast, one of the simplest eukaryotic...scientists can easily observe early developmental stages which can be difficult in other vertebrate species...Craig Mello a Nobel Prize in 2006. One of  major advantages of C. elegans is that they are transparent throughout...

...can be found in Botman et al., 2019 . FP Tagging Yeast tagging vectors to create fusions of proteins of...Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast. 2004 Jun;21(8):661-...plasmids to overexpress various fluorescent markers and tag your proteins of interest with fluorescent proteins...Materials Fluorescent Protein Plasmids & Resources FP Tagging FP Overexpression Resources This comprehensive ...allows for constitutive overexpression of FPs and tagging of genes of interest with FPs in yeast. Characterization...TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication FP Overexpression Plasmids for constitutive...Improved blue, green, and red fluorescent protein tagging vectors for S. cerevisiae. PLoS One. 2013 Jul 2...

...Post About Yeast Vectors Read our Blog Post About Tagging Yeast Genes ...Two hybrid systems were developed in Saccharomyces cerevisiae in 1989 and are still used extensively ...activator (1a) or a repressor (1b). Scientists took advantage of these discoveries to create a new system for...subset based on a cellular compartment or growth stage). A prey library can either be applied to the bait...

...vector with the puromycin resistance gene 63591 3xFN-Tel-TAL/pMXs-neo Expresses a 3xFLAG-tagged TAL protein...Fujii, 2013). In iChIP, specific genomic regions tagged with the recognition sequences of an exogenous ...Fig. 1). In enChIP, specific genomic regions are tagged with engineered DNA-binding molecules such as TAL... 63589 3xFN-Tel-TAL/pCMV-7.1 Expresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat 63590...63590 3xFN-Tel-TAL/pMXs-puro Expresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat. A retroviral...systems using different CRISPR orthologues and epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 ...repeat. A retroviral expression vector with the neomycin resistance gene 64325 3xFLAG-dCas9/p-bacteria ...

...Addgene is certainly going to have to find ways to tag and curate reagents from these emerging organisms...So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research organisms) -  ...

...cloned into an IPTG-inducible His-tag expression vector. All His-tags are cloned at the C-terminus of ...inexpensive to assay, and easy to purify using histidine-tagged constructs and routine protein and molecular biology...a TEV cleavage site is present between the 6xHis-tag and the coding region of MDH. For detailed clone ...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic...

...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...kinase promoter drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO...sulfate, and puromycin are located in the “Appendix”. F.2. Determining the Optimal Puromycin Concentration...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...to fresh puromycin-containing media every other day. f. The minimum concentration of puromycin that results...with finer increments of puromycin to determine a more precise optimal puromycin concentration.) F.3. Protocol...expression of the puromycin resistance gene. f. To select for infected cells, add puromycin to the media at...

...Fluorophore/Tag Green Red None Other Cre-dependent color switch Brainbow constructs Spaghetti monster tags Activity...non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive...dependent 8 Deisseroth 98927 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 CAG GFPsm_myc (does not fluoresce) Cre ...fluoresce) Cre dependent 1 Looger 45185 AAV-EF1a-BbTagBY EF1a TagBFP and EYFP Cre dependent 9 Sanes 45186 AAV-...

...Slow transformation   Spectinomycin/streptomycin Spectinomycin and streptomycin both inhibit protein synthesis.... Pros: Stable (spectinomycin). Cons: Cost (spectinomycin) or stability (streptomycin), doesn’t work for... for transformations. Con: Expensive.   Kanamycin Kanamycin, or kan, is an aminoglycoside which inhibits...Like carb, spectinomycin is the more stable and expensive antibiotic compared to streptomycin. Spectinomycin...cleavage in human cells. Mutagenesis, 20(2), 111–114. https://doi.org/10.1093/mutage/gei016I Resources on ...Spectinomycin/streptomycin can be successfully used for plant and bacterial culture, but some types of bacteria...bacteria.   Zeocin  Zeocin is a member of the bleomycin family of antibiotics, which induce cell death...

...Includes tagging with CFP, YFP, and mRFP Tsoulfas Lab Lentiviral Plasmids - Fluorescently tag your gene...empty plasmid backbones with different fluorescent tags for you to create fusion proteins with your gene... iRFP Gradia Lab Mammalian Plasmids - Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab ...C. elegans Hamdoun Lab Plasmids - Set includes tagging with mCherry, Cerulean, Citrine, and eGFP pPD95... expression Yeast Thorn Lab Vectors - Includes tagging with a wide variety of colors, some specifically...Lindquist Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia...

...cassette in format: PGK-rtTA-2A-puro; see article for tagged insert options rtTA On Root 11651 pLVUT-tTR-KRAB...controls expression of gene of interest with Strep-Tag and Tet-On 3G transactivator, creating an auto-regulated...inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin selection TetR On Wiederschain...On System In 1995, Gossen et al. used random mutagenesis to identify which amino acid residues of tetR...from pCW57.1. rtTA was replaced with tTA, and Puromycin was replaced with Blasticidin selection. Please...

... (CAPTURE.) Tag : Multiple methods make it easier to tag endogenous loci with epitope tags or fluorescent...include mutations seen in human patients, protein tags, or loxP/FRT sites, among others. Homology-directed... not occur in mammalian cells. Purify : Epitope-tagged dCas9 can also be used to purify a genomic locus... EM, Myers RM. 2015. CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res . ...and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and...

...GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes...GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes... 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM...pyogenes 25307933 Vale CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall CEBPB...CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1 M. musculus GGCAACGTTTGACTTCCTGA...Xue RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914...

... Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs...an anti-FLAG antibody to immunoprecipitate FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9...NGG) 42875 pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9...

... ug/mL Bleomycin glycopeptide Induces DNA breaks Bactericidal 5-100 ug/mL Erythromycin macrolide...Additionally, the presence of a plasmid is disadvantageous from the bacterium's perspective – a plasmid-containing...Class Mode of Action*   Working Concentration** Kanamycin aminoglycoside Binds 30S ribosomal subunit; ...mis-translation Bactericidal 50-100 ug/mL Spectinomycin aminoglycoside Binds 30S ribosomal subunit;...protein synthesis Bactericidal 7.5-50 ug/mL Streptomycin aminoglycoside Inhibits initiation of protein...

...backbone contains a kanamycin resistance cassette, you would plate the cells on kanamycin-containing agar..... Only cells carrying plasmids that contain a kanamycin resistance cassette will grow. However, often ...successful uptake of your DNA of interest by taking advantage of bacterial characteristics such as prototrophy...strategy uses the toxin CcdB. Gateway cloning takes advantage of this property by including ccdB on its destination...