Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 93 results for: phage

Showing: 61 - 80 of 93 results

  1. Zhang Lab CRISPR Page

    Type
    Collection
    ...nuclease system involved in defense against invading phages and plasmids. CRISPR loci in microbial hosts contain...

  2. Sequencing Primers

    Type
    Guide
    ...terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter Forward pLXSN 5' (MSCV...

  3. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...systems to defend themselves against bacteriophage infection, but some phages fight back using CRISPR inhibitors...3mnx1/Hb9), pan neuronal (elavl3/HuC), microglial/macrophage (mpeg1.1), and astrocytic (gfap).This toolbox...four proteins from Listeria monocytogenes (Lmo) prophage that can inhibit CRISPR function. These Lmo proteins...

  4. CRISPR Guide

    Type
    Guide
    ...control CRISPR activity. Acr proteins have evolved in phages and other mobile genetic elements to overcome the... edits. These proteins, like Cre recombinase or phage derived serine integrases, insert donor DNA at “... Tolar, J., Osborn, M. J., & Liu, D. R. (2023). Phage-assisted evolution and protein engineering yield...screens in E. coli identify essential genes and phage host factors. PLOS Genetics . 14 (11), e1007749...., Maxwell, K. L., & Davidson, A. R. (2013). Bacteriophage genes that inactivate the CRISPR/Cas bacterial..., J. (2017). Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID...Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors...

  5. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...yeast expression promoter from glyceraldehyde 3-phosphage dehydrogenase Constitutive  Very strong, also ...transcription/ general expression Promoter from T7 bacteriophage Constitutive, but requires T7 RNA polymerase... levels of gene expression Promoter from T7 bacteriophage plus lac operators Negligible basal expression...transcription/ general expression Promoter from Sp6 bacteriophage Constitutive, but requires SP6 RNA polymerase...High levels of gene expression  Promoter from bacteriophage lambda Can be temperature regulatable  Often...transcription/general expression Promoter from T3 bacteriophage Constitutive, but requires T3 RNA polymerase...

  6. Advice for Starting a Biotech Company from a Grad Student turned Entrepreneur

    Type
    Blog Post
    ...on using bacteriophages as bacterial therapeutics. This idea was incorporated into Novophage Therapeutics...engineering and scientific concepts to engineer bacteriophages and use those to detect unwanted bacteria. ...idea of starting a company around engineered bacteriophages. He decided to quit his "safety net" at the...

  7. Antibodies 101: Fc Effector Functions

    Type
    Blog Post
    ...phagocytosis (ADCP), Fcγ receptors on macrophages bind IgG antibodies. The macrophages then engulf and digest the...antibody-dependent cellular phagocytosis for effective macrophage-based cancer immunotherapy.Sci. Adv.8,eabl9171...

  8. Immunology Research Plasmids and Resources

    Type
    Collection
    ...the Michael J Fox Foundation is a synuclein phagemid VHH phage display library used to screen for antibodies...and complement, and specialized cells such as macrophages and neutrophils that attack invading pathogens...presenting cells (APC) including dendritic cells and macrophages. Antigen presentation is mediated by the MHC ...function of innate immune cells including NK cells, macrophages, dendritic cells, and granulocytes. TLR The toll...system. They are found on dendritic cells and macrophages and sense conserved microbial molecules during...FRWS, MGC20661 CSF1 colony stimulating factor 1 (macrophage) MCSF, MGC31930 CSF1R colony stimulating factor...

  9. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ... produces modified dendritic cells (DCs) and macrophages (M1 and M2) that help create welcoming environments...over-express CD47 to escape recognition by circulating macrophages. Tumor cells also downregulate the expression...

  17. Working with Nuclear Receptors

    Type
    Blog Post
    ...physiological states such as adipogenesis and macrophage activation. Our mass spectrometry-affinity purification...

  19. Hot Plasmids - October 2020

    Type
    Blog Post
    ... Cas protein identified exclusively in huge bacteriophage genomes. It’s active in vitro and in human and...
Showing: 61 - 80 of 93 results