We narrowed to 67 results for: phage

...Commonly used surface display platforms include: Phage Display: In this system, a peptide or protein is... to a bacteriophage coat protein. The resulting phages can be screened for binding affinity to a target...

...nuclease system involved in defense against invading phages and plasmids. CRISPR loci in microbial hosts contain...

...control CRISPR activity. Acr proteins have evolved in phages and other mobile genetic elements to overcome the... edits. These proteins, like Cre recombinase or phage derived serine integrases, insert donor DNA at “... Tolar, J., Osborn, M. J., & Liu, D. R. (2023). Phage-assisted evolution and protein engineering yield...screens in E. coli identify essential genes and phage host factors. PLOS Genetics . 14 (11), e1007749....

...terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter Forward pLXSN 5' (MSCV...

...themselves against bacteriophage infection, but some phages fight back using CRISPR inhibitors. Several such...

...control CRISPR activity. Acr proteins have evolved in phages and other mobile genetic elements to overcome the... edits. These proteins, like Cre recombinase or phage derived serine integrases, insert donor DNA at “... Tolar, J., Osborn, M. J., & Liu, D. R. (2023). Phage-assisted evolution and protein engineering yield...screens in E. coli identify essential genes and phage host factors. PLOS Genetics . 14 (11), e1007749....

...Michael J Fox Foundation is a synuclein phagemid VHH phage display library used to screen for antibodies that...