Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 3 results for: phage

Clear keywords
Showing: 1 - 3 of 3 results

  1. Guide to Using Pooled Libraries

    Type
    Guide
    ...Commonly used surface display platforms include: Phage Display: In this system, a peptide or protein is... to a bacteriophage coat protein. The resulting phages can be screened for binding affinity to a target...

  2. Sequencing Primers

    Type
    Guide
    ...terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter Forward pLXSN 5' (MSCV...

  3. CRISPR Guide

    Type
    Guide
    ...control CRISPR activity. Acr proteins have evolved in phages and other mobile genetic elements to overcome the... edits. These proteins, like Cre recombinase or phage derived serine integrases, insert donor DNA at “... Tolar, J., Osborn, M. J., & Liu, D. R. (2023). Phage-assisted evolution and protein engineering yield...screens in E. coli identify essential genes and phage host factors. PLOS Genetics . 14 (11), e1007749....
Showing: 1 - 3 of 3 results