We narrowed to 4 results for: phage

...platforms include: Phage Display: In this system, a peptide or protein is fused to a bacteriophage coat protein...protein. The resulting phages can be screened for binding affinity to a target molecule. Yeast Display: In...the surface of a host cell or virus, such as bacteriophages or yeast. Surface display libraries are useful...

...terminator Reverse pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter Forward pLXSN 5' (MSCV...

...control CRISPR activity. Acr proteins have evolved in phages and other mobile genetic elements to overcome the... edits. These proteins, like Cre recombinase or phage derived serine integrases, insert donor DNA at “... Tolar, J., Osborn, M. J., & Liu, D. R. (2023). Phage-assisted evolution and protein engineering yield...screens in E. coli identify essential genes and phage host factors. PLOS Genetics . 14 (11), e1007749...., Maxwell, K. L., & Davidson, A. R. (2013). Bacteriophage genes that inactivate the CRISPR/Cas bacterial..., J. (2017). Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID...Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors...

...from T7 bacteriophage; requires T7 RNA polymerase Sp6 Constitutive Promoter from Sp6 bacteriophage; requires...Yeast Very strong promoter from glyceraldehyde 3-phosphage dehydrogenase; also called TDH3 or GAPDH TEF1 ...