Skip to main content

We narrowed to 1,036 results for: REN;

Showing: 801 - 820 of 1036 results
  1. Plasmids 101: Protein tags

    Type
    Blog Post
    ...Purification Good for antibody-based purification; has inherent enterokinase cleavage site GST Large Protein...protein as pure as possible? Vectors that offer different combinations of tags are readily available, and...information and some protocols can be found in the references provided. Additional resources: Young CL, Britton...
  2. Designing Your Chalk Talk for the Academic Job Interview

    Type
    Blog Post
    ... the Howard Hughes Medical Institute. Are you currently on or planning to go on the academic job market...if your model is correct or your data favor a different model. Finding evidence for or against a model...the answer to your research problem. Creating a coherent unified story and model can help make your ideas...
  3. Lab to Office Culture Shock

    Type
    Blog Post
    ...jarring for the unprepared, and unfortunately, there aren’t a lot of resources out there for scientists making...tight-knit team like that can and will be a little gut-wrenching, but you can get that feeling of camaraderie again...etc.--so everyone’s experience will be a little different. Some of these changes you may enjoy immediately...
  4. CRISPR 101: Targeting RNA with Cas13a (C2c2)

    Type
    Blog Post
    ...remainder of this blog post. Perhaps the biggest difference between Cas13a and Cas9 is that Cas13a binds ...SHERLOCK (depicted in figure 1) has been used to differentiate strains of Zika virus, genotype human DNA, identify...Gearing contributed to the update of this post. References 1. Abudayyeh, Omar O., et al. "C2c2 is a single-component...
  5. Tips for Writing a Good Cover Letter

    Type
    Blog Post
    ...writer? That’s okay! Your cover letter needs to be coherent and free of typos and grammatical errors. It does...skills and experiences fit the job requirements, strengthened an application. Even so, there were examples...experience, having given more than 20 talks at conferences and taught for five years at [name of the university...
  6. Bioinformatics at Addgene

    Type
    Blog Post
    ... has been crucial for us to keep pace with our current need to analyze nearly 300 sequences each week.... address the need to accelerate science using different approaches. We were also encouraged to see that...pipelines for genomic data. Thanks to the flexibility inherent in Nextflow’s design, we were free to use multiple...
  7. Tips for Getting a Faculty Position

    Type
    Blog Post
    ...no papers, it's unlikely you'll get a job. The currency of scientific success is publications and grants...to convince me that their search committee is different and needs to be told all of the nuances of the...technologies, i.e. video interviews. For point of reference, I submitted my applications all by snail mail...
  8. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...to a mouse model of muscular dystrophy. Three different splice site donor and acceptor sequences were ...for a transgene to be reconstituted, there is currently no one ideal split vector system. Overall the ...greater and more consistent transgene expression. References: Allocca M, Doria M, Petrillo M, Colella P, Garcia-Hoyos...
  9. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...vegetable! What is an RNA aptamer? RNA is not inherently fluorescent and can be challenging to track intracellularly...similar properties to Broccoli despite binding to a different small molecule. Notably, like Broccoli, Red Broccoli...reports on the next additions to aptamer soup! References Alam, Khalid K., et al. "A fluorescent split ...
  10. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...Gram-negative bacteria become resistant to antibiotics! References Espah Borujeni, Amin, Anirudh S. Channarasappa...engineering in bacteria using homologous recombination." Current protocols in molecular biology 106.1 (2014): 1-...for allelic exchange Read our molecular biology reference Watch molecular biology protocol videos ...
  11. CRISPR 101: Homology Directed Repair

    Type
    Blog Post
    ... blog post on Easi-CRISPR for more details. References and resources Want to know more? Check out the...Genome Editing General Homologous Recombination References: Repair of Strand Breaks by Homologous Recombination...Cas-mediated Transgenesis (2018). Pubmed. CRISPR References: Genome engineering using the CRISPR-Cas9 system...
  12. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...Reporter (iGluSnFR) designed and improved by the Loren Looger and Kaspar Podgorski Labs now has a new version...control of one of seven enhancers specific for different interneuron populations. The enhancers span all...effort to develop molecular tools for studying different brain cell types. Look for more of these interneuron-targeting...
  13. Generating Mouse Models Using CRISPR/Cas9

    Type
    Blog Post
    ...therapeutic applications that better human health.     References Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib... Does Not Require Ex Vivo Handling of Embryos. Current Protocols in Human Genetics 88: . https://doi.org...Models Using CRISPR‐Cas9‐Mediated Genome Editing. Current Protocols in Mouse Biology 6:39–66 . https://doi.org...
  14. Transferable Skills Guide: Teamwork

    Type
    Blog Post
    ...Fast forward a few hundred years and there are currently about 5.5 million articles in the English version...a team is a really good way of creating and strengthening those social bonds. So never mind how much better... you find there’s a need for an expertise your current team members don’t have - sometimes you just don...
  15. Sequencing Primers

    Type
    Guide
    ... Educational Resources Molecular Biology Reference Sequencing Primers Sequencing Primers Though Addgene...sequencing primers. These lists are provided for your reference, Addgene does not distribute primers. To identify...DNA, please consult Addgene's Molecular Biology Reference page . Universal Sequencing Primers Name Sequence... Forward Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC...
  16. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...click the "Save" button and jump around to the different pages by clicking on the appropriate boxes at ...at the bottom of the page before moving onto a different page so that any data you enter is not lost.   ...to the backbone, and the vector type. Pro Tip! Reference the Addgene ID in the "Backbone Manufacturer" ...
  17. New FLIS Plasmid (April Fools 2022)

    Type
    Blog Post
    ... this new technology as helpful as we have!  References and Resources Additional resources on the Addgene...Addgene blog:  Flies 101: Catching flies in the lab References Abril, U.N.O., et. al. (2022) A plasmid-based...
  18. SciComm with the Experts at Science in the News Part 1

    Type
    Blog Post
    ... the News hosts a podcast, seminars, a blog, conferences, and more for non-scientists. These programs ...Communicating with Non-Scientists How to Approach Different Audiences Listen to the SITN Podcast Many thanks...
Showing: 801 - 820 of 1036 results