We narrowed to 532 results for: abo.3

...deposit spreadsheet to complete Step 1. Steps 2 and 3 are usually very easy — our tech transfer team will...streptomycin, tetracycline, combinations of the above, or other. High or Low Copy Choose from: high...the “Purpose” field. If you ever have a question about what should go into a cell, hover over the cell ...Addgene and contact your technology transfer office about the MTA. Pro Tip! Download a new spreadsheet each...

...more advantageous for your search. Timesaving Tip #3: Note that protein databases available are unlikely...such as full plasmid sequences provided by the laboratories that deposit their plasmids with us or other...mismatches and gaps in the alignment. If you are curious about the differences in the blastn programs, check out...Inside Look at NGS Plasmid Quality Control Learn about our Snapgene-powered plasmid maps. Resources on...

...end that is identical to an adjacent segment and a 3′ end that anneals to the target sequence. One strategy...reaction: T5 Exonuclease - creates single-strand DNA 3’ overhangs by chewing back from the DNA 5’ end. Complementary...) to the isothermal reaction mix. ET SSB protects 3’ ssDNA ends from the ssDNA-specific endonuclease activity... the right). When designing your plasmid, think about what DNA segments you will need to join to create...

... 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer 3 µL 10x BSA (if recommended) x µL dH 2 O (to... T4 DNA Polymerase or Klenow DNA Polymerase I for 3′ overhang removal and 5′ overhang fill-in. If you ...more at (Link opens in a new window) NEB's website about star activity . If you are digesting a large number...

...PMID: 24552514. PubMed Central PMCID: PMC3929550. 3. Kaati, Gunnar, Lars O. Bygren, and Soren Edvinsson... the histone protein of interest (in the figure above, H3 at K9 or K27). Joined to this by a flexible ... in Your Experiments Post Read Other Blog Posts about Fluorescent Proteins  ...

...Cells Day 2–3 (am): Remove media, replace with fresh media containing selection reagent Day 3–14: Change...300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a single viral dilution to each ...cell death, the cell media should be changed every 2–3 days to maintain the dose of antibiotic, which may...cells in the untransduced well (0 µL lentivirus, above) are dying. Perform regular media changes and monitor...

...ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX... For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse ...Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation...S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5'...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry... pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

...PMID: 25357182. PubMed Central PMCID: PMC4289409. 3. Rouet, Romain, et al. "Receptor-Mediated Delivery...scientists to make genomic alterations, bringing about a revolution in genome engineering, with new techniques...available by both the Jacob Corn and Alex Schier laboratories. Delivering Cas9-gRNA ribonucleoproteins  An...delivery of RNPs is electroporation (A in the figure above), which generates pores in the cell membrane, allowing...as lipid-mediated transfection (B in the figure above), are in the early stages of development. David ...proteins harboring receptor ligands (C in the figure above), which result in the internalization of Cas9-gRNA...show promise for in vivo studies, little is known about the immunogenicity and stability of the Cas9 protein...

...important is letting people know it’s happening. Aim for 3-4 weeks advance notice for the first meeting so that...think about. Choosing a topic and gauging interest The first thing to do if you’ve thought about starting... discussions. Beyond the excitement of learning about new cutting edge science, researchers of all varieties...help stay current on new and emerging work by collaboratively discussing recent publications in a specific...up. At Addgene, we wanted to think more closely about the wealth of high-throughput sequencing (HTS) data...the paper.  Before the first journal club, think about the meeting itself A journal club should aim to ...published science. They also serve as a way to learn about work outside of one's own field in a structured ...

...Amplifying genetic logic gates." Science. 340, 599-603 (3 May 2013). Vivek Mutalik et al. "Precise and reliable...Foundation's Linda Kahl explains the Addgene collaboration this way: "Addgene is one of the leaders in ... our core values." Addgene spoke with Endy more about the BIOFAB and BIL gates plasmid kits, the Biobricks...reference to George Boole who in 1854 was thinking about logic and analyzing human language and observed ... freely available? Endy: When we start thinking about languages, humans have two types of languages: one...does; it's free to use and that tends to be true about most successful human-to-human languages. Who owns...signals. Let's say I wanted to detect every primary metabolite in a cell. The only way to do that at scale right...