Skip to main content
Addgene

We narrowed to 92 results for: AAV Cas9

Showing: 81 - 92 of 92 results
  1. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...fully functional Cas9 upon dimerization. Splitting wild-type Cas9 into n-terminal (Cas9(N)-2xNLS) and c-terminal... can write a blog post about it! Split Cas9 system The Cas9 protein is composed of an n-terminal DNA... the bi-lobed architecture of Cas9 to engineer a series of "split" cas9 molecules that cannot function...activation, the c-terminal cas9 fragment was fused with FK 506 binding protein 12 (Cas9(C)-FKBP-2xNLS) and the... the n-terminal cas9 fragment with FKBP rapamycin binding domain of mTor (Cas9(N)-FRB-NES) resulting in...rapamycin-inducible Cas9 for genome editing. Without rapamycin treatment, the Cas9(N)-FRB-NES fragment...sequence. Treatment with rapamycin induces Cas9(N)-FRB-NES and Cas9(C)-FKBP-2xNLS dimerization and net influx...
  2. Typing CRISPR Systems

    Type
    Blog Post
    ...–C, with the beloved SpCas9 (from Streptococcus pyogenes) belonging in II-A. Cas9 was the first to be ...first time. The discovery and application of CRISPR-Cas9 kicked off over a decade of frenzied interest in...while Class 2 use single protein Cas effectors, like Cas9. The Cascade complex doesn’t usually carry out the...type VI, each relying on a unique Cas effector — Cas9, Cas12, or Cas13. If you’d like to explore Class...most popular and well-known type, as this is where Cas9 falls. The mechanism of type II is, unsurprisingly... Figure 3: Schematic of the basic CRISPR-Cas9 mechanism, representing type II-A. Created with ...effectors and is one of the most popular alternatives to Cas9. Cas12 is unique because it can process multiple...
  3. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...are much smaller proteins than SpyCas9, allowing them to be packaged in AAV vectors, potentially with multiplexed...from Neumann et al. 2024. The team showed that AAV-delivered CHARM could silence the expression of prion... (2024). Brainwide silencing of prion protein by AAV-mediated delivery of an engineered compact epigenetic... a programmable epigenetic editor consisting of dCas9 fused to a DNA methyltransferase — that can drive...DNA-targeting proteins, so the team created versions using dCas9, zinc finger proteins, and transcription activator-like...histone tail (H3K4me0) to a DNA-binding protein (dCas9 shown here). D3L recruits the endogenous, autoinhibited...
  4. PITChing MMEJ as an Alternative Route for Gene Editing

    Type
    Blog Post
    ...containing Cas9 and the PITCh-gRNA. Step 3: Contransfect the PITCh vector with the vector carrying Cas9 and ...plasmic is cotransfected with a plasmid carrying Cas9, the PITCh-gRNA, and the locus-specifc gRNA. The...MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems.” Nat Protoc. 11(1): 118-...advantageous to adapt PITCh to insert genes into AAVS1, the “safe harbor locus” of the human genome, as...
  5. CRISPR Plasmids - Tagging

    Type
    Collection
    ...pX330S-2-PITCh - expresses Cas9 & PITCh-gRNA pX330A-FBL/PITCh - expresses Cas9, PITCh-gRNA, & FBL-specific...#79888) , which expresses an untagged Cas9 AND a gRNA targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG... consists of two components: A vector containing Cas9 and a validated gRNA, based on the Zhang lab's PX458...need to design and clone in a gRNA(s) to guide the Cas9 protein to your target sequence, as well as design...consists of two components: An all-in-one CRISPR/Cas9 vector based on the Zhang lab's PX330 , simultaneously... to generate both an expression cassette for the Cas9-programming sgRNA and HR donors for selectable genome...for integrating at the AAVS1 "safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging ...
  6. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...vectors fantastic options for delivering shRNA, CRISPR/Cas9 components, and fluorescent sensors. Retroviral...Viral Transductions Learn Why You Might Want to Use AAV in Your Research Lentiviral Vector Uses and Overview...
  7. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...cloned into it. gRNAs are used for directing CRISPR/Cas9 to a targeted genomic location, while shRNAs are...in bacteria) such as lentiviral, retroviral, and AAV plasmids, we recommend the NEB Stable strain. For...
  8. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...require the use of lentivirus to deliver the gRNA/Cas9 to target cells. Therefore, you must be equipped...86550 Inhibition Human Weissman 3rd 10 Varies CRISPR/Cas9-assisted Removal of Mitochondrial DNA (CARM) Library...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors... Sabatini and Lander 3rd 50 6,661 Garnett Lab MinLibCas9 Library 164896 Knockout Human Garnett 3rd 2 37,722...
  9. Hot Plasmids and Viral Preps - July 2021

    Type
    Blog Post
    ...of GCaMP8 AAV preps has expanded. Check out the new selection of ready-to-use AAV9 and AAVrg vectors. ...available in AAV8! Expand your imaging experiments with the Cre-OFF/FLP-ON vector 137128-AAV8: Ef1a-Coff...editing in moderate thermophiles.  These evolved SpCas9 variants have improved activity on NAG PAMS and...
  10. Validated gRNA Sequences

    Type
    Collection
    ...single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with targets that are upstream...activity. Know your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this gRNA sequence...and Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish....Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG...10 C. elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C. elegans GCTACCATAGGCACCACGAG...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...
  11. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...capabilities but are small enough to be packaged in AAV particles. Want more information on the wide variety...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...
  12. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...sgHTT51-7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6...-FP Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 ...74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637 ...Parkinson's Frank Soldner 180437 Px330-EGFP-LRRK2-CRISPR/Cas9 LRRK2 U6 Parkinson's Frank Soldner 180439 STR-KDEL_PGRN-SBP-mCherry...Hart 190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51...Parkinson's Hilal Lashuel 36055 pAAV asyn WT SNCA CMV Parkinson's Hilal Lashuel 36056 pAAV asyn S87A SNCA CMV Parkinson's...Hilal Lashuel 36066 pAAV asyn S129A SNCA CMV Parkinson's Patrick Aebischer 36067 pAAV asyn S129G SNCA CMV...
Showing: 81 - 92 of 92 results