Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 208 results for: PHI-1

Showing: 81 - 100 of 208 results

  1. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...discovered such as Kaede and PS-CFP2 (see Table 1). Table 1: Properties of Selected Irreversible Photoactivatable...) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP normally contains a mixed population of neutral...in fluorescence when illuminated with blue light (1). Similar to PA-GFP, scientists later developed red...fixation conditions to preserve cellular structures (0.5-1% osmium tetroxide). These conditions destroy most ...with extraordinary molecular detail.   References 1.Patterson, George H., and Jennifer Lippincott-Schwartz...is believing." Annu. Rev. Biomed. Eng. 10 (2008): 1-38. PubMed PMID:18647110. Additional Resources on ...reversible photoactivation - and have enabled sophisticated imaging techniques.     Irreversible photoactivation...

  2. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...Transposons: The jumping genes. Nature Education 1(1):204. https://www.nature.com/scitable/topicpage/transposons-the-jumping-genes... They transpose by a ‘copy-paste’ mechanism (Fig. 1). They first copy themselves as RNA transcripts and...their host’s genome.   There are two types of Class 1 TEs: those with long terminal repeats (LTRs) and those...reverse transcriptase activities.    Figure 1: Overview of retrotransposon transposition. Retrotransposons...CRISPR-Cas system. This system has four major components: 1) a CRISPR RNA (crRNA), 2) four proteins (TniQ, Cas8...lentivirus). Large cargos, such as the ~11 kB cDNA for dystrophin, the gene mutated in muscular dystrophy, require...

  3. Five Popular Model Organisms, Part 2

    Type
    Blog Post
    ...oxygen. Additionally, its status as a Biosafety Level 1 microbe makes it a perfect candidate for introductory...Transport, biofilms, and much more. Because of it’s BSL-1 status, E. coli can be used as a model to relate these...with superior performance. Nature Communications, 9(1). https://doi.org/10.1038/s41467-018-04899-x Yokoyama..., or frogs, are one of the most popular model amphibians in science with early research providing insight... Jiang, J. P. (2016). Research proceedings on amphibian model organisms. Dong wu xue yan jiu = Zoological...

  4. Hot Plasmids: Winter 2025

    Type
    Blog Post
    ...new combinations of PE protein components (Figure 1), an altered epegRNA delivered with an enhanced pU6cm...amplification of cargo, and heat treatment.  Figure 1: Left: recombined prime editing tools PE2max-NC and...conformational dynamics of the motor protein kinesin-1, the Twelvetrees Lab took advantage of the self-labeling..., Craggs, T.D., & Twelvetrees A.E. (2024) Kinesin-1 is highly flexible and adopts an open conformation...Park, J. C., Zhao, J., Luebbers, A., Green, E., Philibert, C. E., Zhang, H., Layne, M. D., Wu, J. C., & ...

  5. FlipGFP, a novel fluorescence protease reporter to study apoptosis

    Type
    Blog Post
    ...central ɑ-helix that can be split into 3 parts: (1) β-strands 1-9 (β1-9) and the one ɑ-helix, (2) β-strand ...apoptosis in HeLa cells, zebrafish embryos, and Drosophila. They treated HeLa cells expressing FlipGFP with...visualize apoptosis of enterocytes in the midgut of Drosophila, an observation that has been difficult until...

  7. New Tools Enable CRISPRa for Neuroscience Applications

    Type
    Blog Post
    ...by mating with Cre-expressing mice. Figure 1: (A) Schematic of the Cre-dependent SPH construct ... alpha (aCaMKII; excitatory neurons) and Synapsin-1 (pan-neuronal) promoters (Figure 1b), and sgRNAs can...ubiquitous expression of sgRNA(s) and mCherry (vector 1) with neuron-specific expression of dCas9-VPR (Figure...Neuron-specific expression is mediated by the synapsin 1 (SYN) promoter, which was superior in its ability ...immediate-early gene Bdnf, which encodes brain-derived neurotrophic factor (BDNF). Bdnf is expressed early in response...

  8. A Needle in a Base-Stack: Cas9 Structural Biology

    Type
    Blog Post
    ... basic parts of the Cas9 enzyme.   Figure 1: A cartoon depiction of Cas9’s two major lobes, REC...the CRISPR system (Nishimasu et al., 2014). Table 1. Summary of Cas9 domains, the lobe each domain belongs...state (PDB ID 4CMP) with domains colored as in Figure 1. HNH, red; RuvC, orange; CTD, yellow; REC lobe, light... on itself at the bottom of the image. Stem loops 1 and 2 extend horizontally across both lobes. The guide...outside of the protein, spanning both lobes. Stem loop 1, nestled between the REC and CTD domains, is required...Within an interior cavity, Cas9 grips nucleotides 1-10 of the guide RNA, prearranged for base pairing ...343–347. https://doi.org/10.1038/s41586-022-04470-1 Cofsky, J. C., Soczek, K. M., Knott, G. J., Nogales...

  9. Viral Vectors 101: Viruses as Biological Tools

    Type
    Blog Post
    ...unleashes its cargo – its own genome.   Fig. 1: Viral particle infection into a host cell. Image ...Vector Resources at Addgene! References and Resources 1. Roe T, et al. “Integration of murine leukemia virus...nuclear import of human immunodeficiency virus type 1 preintegration complexes.” Proc. Natl. Acad. Sci. ...approved in the US for multiple diseases, including hemophilia B and spinal muscular atrophy.   Type of Virus...

  10. Supporting Reproducibility with a Connected ELN

    Type
    Blog Post
    ...true reproducibility. The following are critical: (1) connectivity to other data sources used in research...engagement with the Wisconsin research community were to: (1) prevent vendor lock in by making it easy to get data...other large research institutions. The following graphic depicts the ways in which the two guiding principles...it difficult or impossible to reproduce. As the graphic depicts, RSpace supports linking to all of the ... other tools and resources. As depicted in the graphic, RSpace is integrated with most of the tools noted...

  11. The PAM Requirement and Expanding CRISPR Beyond SpCas9

    Type
    Blog Post
    ... modify any desired genomic target provided that (1) the sequence is unique compared to the rest of the...will cover three ways to circumvent this limitation: 1) the use of novel S. pyogenes Cas9 variants with varying...Cas9 from Staphylococcus aureus (SaCas9) is about 1 kilobase smaller than SpCas9, so it can be packaged...Biol 19: . https://doi.org/10.1186/s13059-018-1591-1 Cox DBT, Gootenberg JS, Abudayyeh OO, Franklin B, ...Campylobacter jejuni (Cj) NNNNRYAC Streptococcus thermophilus (St) NNAGAAW Treponema denticola (Td) ...

  12. Deep Dive: Statistical Tests (Comparisons)

    Type
    Blog Post
    ... closely data points fall to each other (see Fig. 1). Alpha values – numerical risk allowance in a ...statistical test assumes your data follows. Fig. 1: Examples of comparable groups with and without equal...values from smallest to largest and ranking them (1 being the smallest value). It calculates the cut off...directly manipulating affect an outcome (age, demographic, diet, etc., in a cancer drug clinical trial,...know type of distribution you are working with, graphing data with a histogram is sometimes sufficient ...

  13. Pairing CombiGEM and CRISPR for Combinatorial Genetic Screening

    Type
    Blog Post
    ..., including those found at Addgene! Figure 1: Strategy for assembling the barcoded gRNA library...pool-clone them into the pAWp28 storage vector (Figure 1): Forward oligo: 5’- CACCGNNNNNNNNNNNNNNNNNNNGTTTGGGTCTTCGAGAAGACCTATTCXXXXXXXXC... He can be contacted at [email protected].   References 1. Cheng, Allen A., Huiming Ding, and Timothy K. Lu....26190106. PubMed Central PMCID: PMC4559080. 8. Shalem, Ophir, et al. "Genome-scale CRISPR-Cas9 knockout screening...

  14. Sequencing Primers

    Type
    Guide
    ... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...end of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter... primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor...Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) Drosophila heat shock promoter, forward primer EF-1a Forward...primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F...

  15. Viral Vectors 101: Calcium Sensors

    Type
    Blog Post
    ...want a low affinity calcium biosensor, so that the (1) binding of calcium, (2) allosteric rearrangements... to a red fluorescent state only by simultaneous (1) user-controlled illumination with violet light and...fluorescent indicators. Nature protocols. 2006 Aug;1(3):1057-65. Resources on Addgene.org Addgene’s AAV...GCaMP6 only). The genetic elements required for Drosophila studies have been added for jGCaMP7 and jGCaMP8...

  16. Plasmids for Endogenous Gene Tagging in Human Cells

    Type
    Blog Post
    ...Collection Fluorescent tagging strategy Figure 1: Gene editing is the addition of a useful coding sequence...plasmid design strategy. A donor plasmid contains 1 kb homology arms matching the gene of interest, a ...Institute website at alleninstitute.org. References 1. Roberts, Brock, et al. "Systematic gene tagging using...includes systems for tagging mammalian cell lines, Drosophila cells, and C. elegans. In addition to generating...

  17. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...and drawbacks of four split AAV vector approaches. 1. Overlapping  Overview: The overlapping strategy has...Adeno-Associated Virus Capsids. Human Gene Therapy Methods 27:1–12 . https://doi.org/10.1089/hgtb.2015.140 Frischmeyer...deliver the mini-dystrophin gene to a mouse model of muscular dystrophy. While mini-dystrophin expression levels...levels were lower than expression of wild-type dystrophin in normal muscles, mice treated with the overlapping... trans-splicing vector to deliver a 6 kb mini-dystrophin gene to a mouse model of muscular dystrophy. ...achieved ~80% of muscle cells expressing mini-dystrophin.  3. Hybrid  Overview: The hybrid approach combines...Gene Therapy of mdx Mice With Large Truncated Dystrophins Generated by Recombination Using rAAV6. Molecular...

  18. COVID-19 Resources

    Type
    Collection
    ...mediating the entry of SARS-CoV and SARS-CoV-2 viruses. ( 1 ) TMPRSS2 - a serine protease that primes the SARS-CoV...transcriptase expression plasmids from the Drew Endy and Philippa Marrack Labs. Point-of-care testing for COVID-...

  19. Open Resources and Plasmid Tools For Studying C. elegans

    Type
    Blog Post
    ...Zhang et al., 2015). In this system a modified TIR-1 protein can degrade degron-tagged proteins in an auxin...splitting cGAL4 in two and binding each half to a gp41-1-N-intein. Split inteins are protein domains that naturally...mutations with unc- 119 + selection." MicroPublication 1 (2018): 2–3. Wang, Han, et al. "cGAL, a temperature-robust...by members of the worm community but there are Drosophila and zebrafish articles published there as well...

  20. Adeno Associated Virus (AAV) for Cell and Gene Therapy

    Type
    Blog Post
    ...reconstitution with a normally functioning T cell repertoire (1). In this example, it was possible to transduce the...significant improvements in vision over a period of 1 to 3 years – the treatment appears to be both safe...research and science communication.     References 1. Gaspar, H. B., S. Howe, and A. J. Thrasher. "Gene...directed at diseases including but not limited to hemophilia B, LPL deficiency, Cystic fibrosis, Muscular ...
Showing: 81 - 100 of 208 results