Skip to main content

We narrowed to 7 results for: PHI-1

Showing: 1 - 7 of 7 results
  1. Sequencing Primers

    Type
    Guide
    ...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse... 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC...mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...
  2. Promoters

    Type
    Guide
    ... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate... Ac5 Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires...regulatory element and yeast Gal4 gene; often used in Drosophila Polyhedrin Constitutive Insect Strong promoter...
  3. Molecular Biology Reference

    Type
    Guide
    ...Invitrogen F- Phi80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1...StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15 Δ-lacX74 recA1 araD139... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...Survival Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZΔM15 Δ-lacX74 recA1 araΔ139 D(ara-leu)7697 galU galK...
  4. CRISPR Guide

    Type
    Guide
    ...changing the target sequence present in the gRNA. Figure 1: Overview of the basic CRISPR mechanism. CRISPR was...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...
  5. Modular Cloning Guide

    Type
    Guide
    ...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...Genome Engineering, CRISPR, Mammalian Expression, Drosophila John Doench 180-plasmid toolkit for rapid creation...
  6. Optogenetics Guide

    Type
    Guide
    ...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L... in model organisms like mice, zebrafish, and Drosophila. These tools have been instrumental in neurological...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...inherited retinal disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many...
Showing: 1 - 7 of 7 results