Skip to main content
Addgene

We narrowed to 395 results for: POR C

Showing: 81 - 100 of 395 results
  1. Simplify Cloning with in vivo Assembly

    Type
    Blog Post
    ... added to the PCR mix to remove parental DNA (37 °C for 15 mins). This enzyme specifically cuts methylated...region, with a melting temperature (Tm) of around 60 °C for all primers. The length of the homologous region...recombination. We normally use a Tm between 47-55 °C for the homologous region (calculated using Oligo ...product. For example, by combining multiple primers, a C-terminal epitope tag can be moved to the N-terminus...pathway is ubiquitous, with successful recombination reported in all laboratory E. coli strains tested so far...use of this pathway as a cloning tool was first reported over 25 years ago (Douglas and Howard, 1991, Bubeck...cloning strain has failed so far. What is most important is the transformation efficiency of the strain...
  2. To Codon Optimize or Not: That is the Question

    Type
    Blog Post
    ...cells. For example, Henry Lester’s lab optimized the C. elegans GluCl ion channel genes for expression in...Santana-Quintero LV, Katneni U, Simonyan V, Kimchi-Sarfaty C (2017) A new and updated resource for codon usage ...–34 . https://doi.org/10.1038/nsmb1031 Gustafsson C, Govindarajan S, Minshull J (2004) Codon bias and ...doi.org/10.1093/nar/28.1.292 Sauna ZE, Kimchi-Sarfaty C (2011) Understanding the contribution of synonymous... in a particular organism. Why is codon usage important? Translation and protein synthesis relies on transfer...deliver amino acids to the ribosome where they are incorporated into the growing polypeptide chain. One part...even been linked to some diseases. It has been reported that 5-10% of human genes contain a region where...
  3. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...J.G., Wohnoutka, P., Gerfen, C.R., Koch, C., Bernard, A., Dang, C., Jones, A.R., and Zeng, H. (2014). A ..., J. M., Vandenberghe, L. H., Haute, C. V., Thiry, I., Deroose, C. M., Mortelmans, L., Wilson, J.M., Debyser... Ravi, N., Wu, W.-L., Sánchez-Guardado, L., Lois, C., Mazmanian, S.K., Deverman, B.E., and Gradinaru, ...Winslow, B., Cain, N., Mihalas, S., Wang, Q., Lau, C., Kuan, L., Henry, A.M., Mortrud, M.T., Ouellette,... E., Tanaka, M., Kearney, M., Chattree, G., Yang, C. F., Shah, N.M., and Mooney, R. (2017). Identification...Res 406(1-2), 317-321. PubMed PMID: 2436717. Towne, C., Schneider, B.L., Kieran, D., Redmond, D.E.Jr., and... facilitate transport: retrograde transport relies on dynein, while anterograde transport relies on kinesin...
  4. The AAVantages of AAV in CRISPR Screens

    Type
    Blog Post
    ...References and Resources References Braun, C. J., Adames, A. C., Saur, D., & Rad, R. (2022). Tutorial: design...Sousa, A. A., Tsai, S. Q., Bengtsson, N. E., Lööv, C., Ingelsson, M., Chamberlain, J. S., Corey, D. P.,...M. J., Joung, J. K., Breakefield, X. O., Maguire, C. A., & György, B. (2019). High levels of AAV vector...CRISPR screens rely on lentiviral systems, a fact supported by the wide array of lentiviral-based CRISPR libraries...locations that could cause deleterious effects. It is important to note, however, that while AAV rarely integrates..., CRISPR may increase this rate. Specifically, portions of the AAV genome can integrate at double-stranded...
  5. Plasmids 101: How to Name Your Plasmid in 3 Easy Steps

    Type
    Blog Post
    ...resistance, b) the promoter that drives the insert, and c) any other selection markers (for use in other cell...pBACKBONE-Flag-hGene If there was also an EGFP fused to the C-terminal of your insert you would list it after the...identify what your plasmid contains and other important information. Tip: A lowercase "p" is often used...simple piece of information can often convey many important details. Once you know the backbone a plasmid ...
  6. PRIDICT: Predicting Efficiencies of Prime Editing Guide RNAs

    Type
    Blog Post
    ... Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C., Newby, G. A., Raguram, A., & Liu, D. R. (2019). ..., X., Chen, W., Martin, B. K., Calderon, D., Lee, C., Choi, J., Chardon, F. M., McDiarmid, T. A., Daza...Kissling, L., Marquart, K. F., Schmidheini, L., Solari, C., Balázs, Z., Krauthammer, M., & Schwank, G. (2023...-024-02268-2 Schep, R., Brinkman, E. K., Leemans, C., Vergara, X., van der Weide, R. H., Morris, B., van... In our study, we used the TRIP (Thousands of Reporters Integrated in Parallel; Akhtar et al., 2013; Schep...Chromatin Position Effects Assayed by Thousands of Reporters Integrated in Parallel. Cell, 154(4), 914–927....
  7. INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons

    Type
    Blog Post
    ....1126/science.abb2920 Vo PLH, Ronda C, Klompe SE, Chen EE, Acree C, Wang HH, Sternberg SH (2020) CRISPR...and require only two transposase proteins (TnsB and C). While requiring fewer components for RNA-guided ...Rubin BE, Diamond S, Cress BF, Crits-Christoph A,  He C , Xu M, Zhou Z, Smock DC, Tang K, Owens TK, Krishnappa...genomes engineering In the Sternberg group’s initial report of VchINT, three separate plasmids and multiple...simple to use, users should keep aware of a few important details. For transposons to be specifically recognized...
  8. Viral Production at Addgene

    Type
    Blog Post
    ...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...preparations are then aliquoted, frozen, and stored at -80 °C. Concentrated lentiviral preparations (“-LVC” catalog...expression and/or function. These data are sometimes reported or posted on the material page for the corresponding...recipient’s initial thaw will be accounted for in our reported titers. Lentiviral vectors are titered using a...
  9. Antibodies 101: Epitope Tags

    Type
    Blog Post
    ...Epitope tags are short peptides introduced at the N or C terminus of a protein that are bound by antibodies...enterokinase, which recognizes the 5 amino acids on the C terminal of the tag. Of the most common tags, FLAG...not at all. The introduction of a tag at the N or C terminus of a protein may disrupt the biological function...destabilization can be brought about by the tag so it’s important to validate tagged protein functionality (Arribere...
  10. Hot Plasmids - September 2019 - CRISPR, Auxin Inducible Degradation, MerMAID Channelrhodopsins, and Genome Looping

    Type
    Blog Post
    ...please sign up here.        New toolkit for N or C terminal tagging of proteins for degradation using...has created a new toolkit of plasmids for the N- or C- terminal tagging of proteins with mAID and other ...cytidine deaminase  Target-AID-NG, which mediated a C to T conversion in the target sites adjacent to an...Earlier this year, the Hegemann lab and collaborators report their discovery of a new family of seven ChRs derived...
  11. Antibodies 101: Multiplex Immunofluorescence

    Type
    Blog Post
    ... Boeckman, J. X., Manning, C. F., Nguyen, J. T., Bechtold, H., Dumitras, C., Gong, B., Nguyen, K., Van...-GABA-AR β1 (white) and anti-GABA-AR β3 (green). (C) Hippocampus labeled with anti-Kv2.1 (magenta), anti-AnkyrinG... Panels C1-C3 show magnified detail of the box in C. Image adapted from Andrews et al., 2019 under CC-... J., Kandov, E., Lowekamp, B., Speranza, E., Chu, C. J., Gola, A., Thakur, N., Shih, R., Yao, L., Yaniv...protocol is a good place to get started.  One important consideration when deciding whether you can do...specific considerations to keep in mind. Most importantly, make sure you are using primary antibodies from...
  12. Viral Vectors 101: The Retroviral Lifecycle

    Type
    Blog Post
    ...4355596 King, S. R., Duggal, N. K., Ndongmo, C. B., Pacut, C., & Telesnitsky, A. (2008). Pseudodiploid Genome...A., Hunter, E., & Kappes, J. C. (1997). Functional RT and IN incorporated into HIV-1 particles independently...34372494. Prussin, A. J., Garcia, E. B., & Marr, L. C. (2015). Total Virus and Bacteria Concentrations in...
  13. Luciferase Plasmid Collection

    Type
    Collection
    ...Multi-luciferase reporter vector including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK...pathway in vivo . DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Nano-lanterns , Enhanced Nano-lanterns...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Taipale 87065 pcDNA3.1-ccdB-Renilla Renilla Creation of C-terminal Renilla luciferase fusions using Gateway ...Taipale 87066 pcDNA3.1-ccdB-Firefly Firefly Creation of C-terminal Firefly luciferase fusions using Gateway ... 87074 pLenti6.2-ccdB-Firefly Firefly Creation of C-terminal Firefly luciferase fusions using Gateway ...
  14. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ... Sellnow, R. C., Boye, S. L., Coberly, B., Bennett, A., Agbandje-McKenna, M., Sortwell, C. E., Hauswirth...Backer, M. W. A., Brans, M. A. D., Luijendijk, M. C., Garner, K. M., & Adan, R. A. H. (2010). Optimization...Dudek, A. M., Pillay, S., Puschnik, A. S., Nagamine, C. M., Cheng, F., Qiu, J., Carette, J. E., & Vandenberghe..., J. Y., Han, J. H., Lee, H., Han, Y. E., Rah, J. C., & Park, H. (2020). Labeling dual presynaptic inputs...injection site  (Kanaan et al., 2017), axonal transport  (Murlidharan et al., 2014), and postsynaptic ... system, remember that some serotypes can be transported retrogradely and/or anterogradely along the axon...et al., 2014; Nieuwenhuis et al., 2021). It is important to note that this expression pattern can be affected...
  15. Antibodies 101: Normalization and Loading Controls for Western Blots

    Type
    Blog Post
    ...independent blots. B–C) Graphs showing the relative intensity of the β-actin (B) or total protein (C) on the membrane...quantification in panel B is not especially linear. In panel C, two different methods of quantifying total protein...linear. Note the different y-axes between panels B and C, indicating that β-actin is less sensitive as well...BioRender.com. Loading controls are even more important for semi-quantitative western blots. No pipetter...in the same lane, and the resulting fraction is reported. Figure 2: Normalization with loading controls...equally strong, so the normalized value simply reports which POI band is stronger. The right gel has exactly...abundance on your membrane, which would be directly reported by band intensity. Researchers use later steps...
  16. Validated gRNA Sequences

    Type
    Collection
    ...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...
  17. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    ... was reduced by growing seed stocks at 30°C compared to 42°C. Screen multiple colonies to isolate the ...19763938. Maucksch C, Bohla A, Hoffmann F, Schleef M, Aneja MK, Elfinger M, Hartl D, Rudolph C. Transgene expression...Growing the culture at a lower temperature such as 30°C or optimizing the incubation time can help maintain...long-read sequencing techniques, such as Oxford Nanopore sequencing or PacBio SMRT sequencing, (which differ...long-read sequencing (1-25 kb), such as Oxford Nanopore sequencing or PacBio SMRT sequencing. These longer... plasmid multimerization troubleshooting tips. Portions of this figure were made with BioRender. ...AE. Generic plasmid DNA production platform incorporating low metabolic burden seed-stock and fed-batch...
  18. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...optimum of 30 °C and is therefore inefficient in mammalian cells (usually grown at 37 °C). Smart molecular...identification of FLPe which has a temperature optimum of 37 °C (Buchholz, Angrand, and Stewart 1998). FLPe’s performance... receptor (ER) ligand binding domain (LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These...FLP-FRT. In addition, a variety of means to spatiotemporally control FLP and Cre expression have been developed...These differences in recombinase efficiency are important to keep in mind when deciding whether to use the... only occur at a specific time point? To allow temporal control, ligand regulated Cre and FLPe recombinase...control of Cre recombinase. After in-utero electroporation, this plasmid mix results in sparse labeling...
  19. pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs

    Type
    Blog Post
    ...the reprogramming factors- OCT3/4, SOX2, KLF4, and C-MYC [1]. For the derivation of clinical grade hiPSCs...vectors that encoded six factors - OCT3/4, SOX2, KLF4, C-MYC, LIN28 and SV40 large T antigen (SV40LT). The ...of TP53 enhances iPSC generation as does replacing C-MYC with L-MYC [10, 11]. While the mechanisms underlying...understood, the addition of an shRNA for P53 and replacing C-MYC with L-MYC in the episomal reprogramming cocktail...into cells by electroporation. hiPSC colonies are obtained by 10 days after electroporation, most of which...over a decade back when Yamanaka and colleagues reported that it is possible to reprogram differentiated...generation of human iPSCs (hiPSCs) now provides an opportunity to develop and use patient-specific somatic cells...
  20. Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

    Type
    Blog Post
    ...21356876. 5. J. Chow, Z. Marka, I. Bartos, S. Marka, J. C. Kagan, Environmental Stress Causes Lethal Neuro-Trauma...PubMed PMID: 28704652. 6. V. Rodríguez, D. Didiano, C. Desplan, Power tools for gene expression and clonal...Neurosci. 9, 703–709 (2006). PubMed PMID: 16582903. 8. C. J. Potter, B. Tasic, E. V Russler, L. Liang, L. Luo...you to systematically study gene function with temporal control and cell-type specificity! The Gal4/...
Showing: 81 - 100 of 395 results