We narrowed to 89 results for: bad

.... M., Komor, A. C., Rees, H. A., Packer, M. S., Badran, A. H., Bryson, D. I., & Liu, D. R. (2017). Programmable...

...downstream of the arabinose (Ara)-inducible promoter (PBAD), and the A118 gene downstream of the diacetylphloroglucinol...

...-inducible lac promoter, the arabinose-inducible pBAD promoter and the endogenous phage pL promoter.  ...

....1258096 Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR (2018) Publisher Correction...

... Find plasmids from this paper at Addgene. 2. Kabadi, Ami M., et al. “Multiplex CRISPR/Cas9-based genome...

...-To-T Base Editing. Advanced Science (Weinheim, Baden-Wurttemberg, Germany), 9(26), e2202957. https://...

...Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD promoter Forward pBAD Reverse...Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse pBluescript KS TCGAGGTCGACGGTATC...Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse pBluescriptKS TCGAGGTCGACGGTATC...GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of...

.... Science , 337 (6096), 816–821. PMID: 22745249 Kabadi, A. M., Ousterout, D. G., Hilton, I. B., & Gersbach.... M., Komor, A. C., Rees, H. A., Packer, M. S., Badran, A. H., Bryson, D. I., & Liu, D. R. (2017). Programmable...., Waterbury, A. L., Koblan, L. W., Kim, Y. B., Badran, A. H., & Liu, D. R. (2017). Improved base excision...

...lacI or lacIq). Can be induced by IPTG or lactose araBAD Inducible by arabinose Promoter of the arabinose...