We narrowed to 653 results for: EPO

1. The Materials Science of Optogenetics Experiments

   Type

   Blog Post

   ...wirelessly-controlled optogenetic implants have been reported by several groups [4, 5, 6]. These have the obvious...

2. How-to: 5 Steps to a Great Panel Discussion

   Type

   Blog Post

   ...published on LinkedIn. Follow Addgene on LinkedIn for repository news and updates. Panel discussions are becoming...

3. Story of a SynBio Startup: RevBio's Epiphany (or Lack Thereof)

   Type

   Blog Post

   ... a pizza joint. Silly ideas (mining local salt deposits to sell at farmers markets), and serious ideas...

4. Validated gRNA Sequences

   Type

   Collection

   ...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...possible on the sequences, and email the file to deposit@addgene.org with the subject heading "gRNA sequence...

5. Zinc Finger Consortium Reagents

   Type

   Collection

   ...engineering and expressing zinc finger proteins deposited by Zinc Finger Consortium members like the Joung...Consortium members Keith Joung and Daniel Voytas have deposited at Addgene various reagents for engineering and...

6. Production of Virus in Insect Versus Mammalian Cells

   Type

   Blog Post

   ...producing virus within 24 to 48 hours. Harvesting timepoints will depend on your specific virus, so this is...

7. Viral Vectors 101: Producing Your rAAV

   Type

   Blog Post

   ...different titers are measured. A TCID50 measurement reports an infectious titer, meaning the concentration ...

8. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

   Type

   Blog Post

   ... Signaling and Protein Purification RANbodies: Reporter Nanobody Fusions Plasmids 101: Secondary Nanobody...

9. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

   Type

   Blog Post

   ...improved expression in living cells. Scientific Reports, 9(1). https://doi.org/10.1038/s41598-019-48604...

10. The Scientific Conference Poster Session: Tips for Success

    Type

    Blog Post

    ...Addgene website Become of a member of the Addgene depositor community Learn about careers at Addgene ...