Skip to main content

We narrowed to 1,002 results for: DES

Showing: 1001 - 1002 of 1002 results
  1. Sequencing Primers

    Type
    Guide
    ...primers. You can also use Addgene's protocol to design your own primers . Still have questions about choosing... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...
  2. Educational Resources

    Type
    Guide
    ...educational resources, including eBooks, science guides, videos, and protocols...Creating Bacterial Glycerol Stocks Restriction Digests Guides Browse our in-depth instructional content on subjects...
Showing: 1001 - 1002 of 1002 results