Skip to main content

We narrowed to 740 results for: SON;

Showing: 251 - 300 of 740 results
  1. Plasmids 101: Stringent Regulation of Replication

    Type
    Blog Post
    ...restraining further replication.   Figure 3: Comparison of replication regulation mechanisms of stringently...regulation! This post was originally written by Jason Niehaus in December 2015 and was updated by Emily...464.1998 Grimwade, J. E., Rozgaja, T. A., Gupta, R., Dyson, K., Rao, P., & Leonard, A. C. (2018). Origin recognition.../doi.org/10.1093/nar/gky457 Park, K., Han, E., Paulsson, J., & Chattoraj, D. K. (2001). Origin pairing...
  2. Viral Vectors 101: Pseudotyping

    Type
    Blog Post
    ...host tropism of your virus, there are many other reasons when you might pseudotype your virus:  Lowering...a cell surface to endocytose into the cell. The reason VSV-G is so commonly used is that it is good at...Sandoval, 2017). This high titer is one of the reasons VSV-G is used to transduce stem cells and neurons...https://doi.org/10.1093/hmg/10.19.2109 Sandrin V, Boson B, Salmon P, Gay W, Nègre D, Le Grand R, Trono ...
  3. Sequencing Primers

    Type
    Guide
    ...GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...
  4. Tips for Getting a Faculty Position

    Type
    Blog Post
    ... make the best case for your candidacy. A major reason that a lot of candidates either get no interviews...understand your cover letter and research statement. My personal litmus test was whether my wife could explain ... please introduce yourself to me by email or in person. If you feel compelled to repay me in some way,...job searches. If you feel the urge to repay me personally, I will gratefully accept a very hoppy pint of...
  5. Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

    Type
    Blog Post
    ...progeny are produced (Figure 1).  Figure 1: Comparison of the life cycle of a lentiviral vector with...integrase-deficient lentiviral vectors? There are several reasons why you might choose an IDLV over a lentiviral ...This blog post was written by Addgenie Rebecca Hutcheson.   References and resources References Banasik...PMC2835240 Wu Y. (2004). HIV-1 gene expression: lessons from provirus and non-integrated DNA. Retrovirology...
  6. March for Science

    Type
    Blog Post
    ...believe GMOs are safe for human consumption in comparison to 37% of the general public (5, 6). Similarly... the public (8–13). Facing the possibility that reason is losing ground in public discourse, many scientists...politicians to interpret it for them. Other popular reasons to march include: General inclusion of science...policy should have more weight than how any one person feels about it. And yet research shows that thoughts...
  7. Using Phosphoserine to Study Protein Phosphorylation

    Type
    Blog Post
    ...fellow at the Morgridge Institute for Research in Madison, Wisconsin. It is commonly cited that approximately...enzyme function, protein interaction, etc. by comparison to non-phosphorylated or ‘wild type’ control ...dephosphorylation reaction can be tracked through the comparison of phospho:non-phospho species on PhosTag gels...fellow at the Morgridge Institute for Research in Madison, Wisconsin. She is particularly interested in the...
  8. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...nuclear- or DNA-binding proteins, you may need to sonicate your lysates in order to release the proteins ...you’re using chemical blockers, you can run a comparison of different formulations instead of concentrations...temperature, and/or buffer to increase lysis Add sonication step to protein lysis Splice variants Check...lysing buffer/adjust lysing buffer strength Sonication based lysing protocol Subcellular fractional...  Rachel Leeson...
  9. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...Addgene. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA...publication at Addgene. Maeder ML, Angstman JF, Richardson ME, Linder SJ, Cascio VM, Tsai SQ, Ho QH, Sander...Sander JD, Reyon D, Bernstein BE, Costello JF, Wilkinson MF, Joung JK (2013) Targeted DNA demethylation... this publication at Addgene. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein...
  10. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...Single-chain variable fragment (ScFv) Figure 2: Comparison between the IgG antibody and scFv. Because...Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies are the...10.1016/j.ymeth.2017.01.009 Crivianu-Gaita V, Thompson M (2016) Aptamers, antibody scFv, and antibody...antibody Fab’ fragments: An overview and comparison of three of the most versatile biosensor biorecognition ...
  11. With an Eye Towards the Future, We Look Back at the March for Science

    Type
    Blog Post
    ... work, funding for science, and numerous other reasons. It is important to remember that we, scientists...Albany, NY, USA 42.6526°N 73.7562°W – Nicholas Thompson Over the last few years, there's been a disturbing...positive event that I hope happens again. Nicholas Thompson is a PhD Candidate studying Nuclear Science and...enforcement, and, although there was at least one person vocally protesting us, he was not threatening in...
  12. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ...Many thanks to our guest blogger, Doug Richardson! Doug Richardson is the Director of the Harvard Center...This post was contributed by Doug Richardson, Director of the Harvard Center for Biological Imaging and... 2, 932-940 (2005). PubMed PMID: 16299478. 9. Richardson DS, Lichtman JW. Clarifying Tissue Clearing. ...
  13. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ... appear within a range of wavelengths. For that reason, we speak of excitation and emission spectra. Both... happens due to a process called Fluorescence Resonance Energy Transfer (FRET).   Figure 1: Emission...fused to CD45, but is separately expressed. (The reason for having a separately expressed transduction ...difficult. I chose BV421 for the following two reasons: 1) The emission spectrum of BV421 is far enough...
  14. Selecting Your Plasmid Purification Kit

    Type
    Blog Post
    ... something is working for you, then there is no reason to change it. But what if a kit isn’t working for...variety of manufacturers. It also includes a rough comparison of list price between these manufacturers, as...kits before deciding which one to buy. Table 3: Comparison of popular plasmid purification kit options ...blog post was written by Ashley Waldron, Hannah Dotson, and Nyla Naim. Resources Additional resources...
  15. #DeckTheLab with Tinsel and Test Tubes, Fa La La La La La La La La

    Type
    Blog Post
    ...for near-freezing temperatures, our first of the season snow flurries, dusting off the winter coats and... to #DeckTheLab with virus snowflakes from @CVRHutchinson #SciArt #STEAM #WinterWonderlab @Addgene Make...WFH space feel a little more festive this holiday season! It is that time of the year again: miniature ...
  16. Performing In Vivo CRISPR Screens Using the FITS Approach

    Type
    Blog Post
    ...vivo T cell Screens (FITS) approach (Milling and Markson et al., 2024), developed and deposited at Addgene.... Figure used with permission from Milling and Markson et al., 2024.   Proof of concept The FITS approach...cancer.   References and resources Milling, L. E., Markson, S. C., Tjokrosurjo, Q., Derosia, N. M., Streeter...
  17. New Viral Vectors - March 2024

    Type
    Blog Post
    ...PHP.eB Controls Wilson New viral vector pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype... Rachel Leeson...
  18. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...Serotype Category Depositor  Notes pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE AAV1, AAV5 Optogenetics...Biosensors Li New viral service pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG...resources!   This blog post was written by Rachel Leeson and Brian O'Neill.  More resources on the Addgene...
  19. Working 9-5: an Addgene Co-op

    Type
    Blog Post
    ...description of the tasks I would be responsible for, in comparison to the other positions listed with a much less...flexibility was the ability to work either remotely or in person. This was useful to me as some days it was not ...their employees are feeling comfortable.     Lucie Wilson is a rising junior and bioengineering student at...
  20. Who Gives a Tweet? 9 Facts About Scientists on Twitter

    Type
    Blog Post
    ...note that these results could be biased for two reasons: 1) they are based on the US Occupational Employment...nonscientists, blur the line between professional and personal on Twitter. Or maybe scientist prefer to share...Tips: Online Social Networking for Scientists 5 Reasons to Use Reddit for Science Communication 10 Ways...
  21. Early Career Researcher Toolbox: Free Online Molecular Biology Tools

    Type
    Blog Post
    ...primers for In-Fusion Cloning Design primers for Gibson Assembly and NEB HiFi DNA Assembly  OligoAnalyzer...cloning methods, such as restriction enzyme cloning, Gibson assembly, or In-Fusion cloning.  NEB Ligation ...resources were added in September 2023 by Rachel Leeson.  Additional resources on the Addgene blog: ...
  22. Understanding GPCR Signaling Using TRUPATH

    Type
    Blog Post
    ...Bioluminescence Resonance Energy Transfer (BRET). BRET is similar to Förster Resonance Energy Transfer...heterotrimeric G protein dissociation by bioluminescence resonance energy transfer 2, or BRET2. With binding of the...
  23. Addgene's a Nonprofit? Nonprofit Awareness Day 2017

    Type
    Blog Post
    ...scientific community, what other reasons do we like being a nonprofit? One big reason is that scientists and technology..., Eric, Gizela, Henry, Ina, Inna, Ishrat, Jane, Jason, Jessica, Joel, Jonathan, Justine, Karen, Kate, ...
  24. 10 Ways to Share Your Science!

    Type
    Blog Post
    ...matters! There are important societal reasons, self-interested reasons, and, given that science is largely...largely funded by tax-payers, there are reasons to feel obligated too, as experts on the subject brought out...
  25. CRISPR Challenges: Standardization and Homology Directed Repair

    Type
    Blog Post
    ... mind from that session were words from Eric Hendrickson, loosely paraphrased in the tweet below. The... DNA for Enhanced CRISPR Genome Editing Chris Richardson and members of Jacob Corn’s lab describe how ...Yinan, Brian Ruis, Taylor Takasugi, and Eric A. Hendrickson. Genome Res 27(7) (2017):1099-1111. PubMed PMID...
  26. New and Upcoming Viral Vectors - June 2019

    Type
    Blog Post
    ...AAV9  pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 124603  AAV9  pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-...affect DREADD trafficking and localization. The Sternson lab recently deposited PSAM AAV, which encode ...
  27. Visualizing Genomic Loci with CRISPR-Sirius

    Type
    Blog Post
    ...visualization tools using CRISPR In 2015, Thoru Pederson’s lab at the University of Massachusetts Medical...CRISPR-Sirius Recently, Hanhui Ma and the Thoru Pederson lab developed CRISPR-Sirius (Ma et al., 2018)....order to label two loci simultaneously, Ma and Pederson created another sgRNA containing the PP7 hairpin...
  28. Finding and Joining Your Dream Lab

    Type
    Blog Post
    ...science trainee will spend 4-7 years working for one person and with a group who all strive for a common big-picture...rotation, which reveals their working habits, personality, and gives them the opportunity to see if the...extreme openness” of the lab (i.e projects like the Personal Genome Project and open source software, hardware...
  29. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...comparable experimental results. Using PiggyBac transposons, the Woltjen Lab compared different variants ...reprogramming discrepancies. The polycistronic piggyBac transposon vectors tested in this work are available at ...tool for use as a donor in FRET (fluorescence resonance energy transfer) and FLIM (Fluorescence Lifetime...1kb fragments are produced (see figure above). 3 Reasons The PSU Ladders Are Awesome Tools: They are comprised...
  30. Hot Plasmids - May 2022

    Type
    Blog Post
    ...error rate for long sequence knock-ins by: Lucie Wilson Le Cong’s lab has developed a method using dCas9...error rates overall ranged from 0.3% to 10%, in comparison to the 62-90% error rate seen with Cas9 editors...barcodes for live cell clonal multiplexing by: Rachel Leeson Multiplexed images in live cells remains a challenge...
  31. Hot Plasmids - February 2022

    Type
    Blog Post
    ... variations in DR sequences. Figure 2: comparison of Cas 9 vs. Cas 12a expression cassettes when...0600-6. The Penn State Protein Ladder  by: Rachel Leeson This simple, inexpensive plasmid-based ladder system...mammalian genome regulation and editing by: Rachel Leeson The large size of CRISPR-Cas effectors and fusion...
  32. Antibodies 101: Monoclonal Antibodies

    Type
    Blog Post
    ...Bradbury ARM, Trinklein ND, Thie H, Wilkinson IC, Tandon AK, Anderson S, Bladen CL, Jones B, Aldred SF, ...JoVE. https://doi.org/10.3791/54832  Lipman NS, Jackson LR, Trudel LJ, Weis-Garcia F (2005) Monoclonal ...
  33. Viral Vectors 101: Types of viruses

    Type
    Blog Post
    ... proto-oncogenes and disrupt their expression (Robinson, 1982). To add insult to injury, retroviruses ...immunogenicity low! References and Resources References Robinson HL. Retroviruses and cancer. Rev Infect Dis. 1982...Gene and Cell-Based Therapies in the New Era of Personalized Medicine. Genes Dis. 2017 Jun;4(2):43-63. DOI...
  34. Fluorescent Proteins 101: Luciferases

    Type
    Blog Post
    ... (fluorescent and luminescent) worlds Forster Resonance Energy Transfer (FRET) is the transfer of energy...which then emits it as light. Bioluminescence Resonance Energy Transfer (BRET) works the same way, except...tips below! This post was originally written by Jason Niehaus in June 2014 and was updated by Emily P....
  35. Multiplex Genome Editing with CRISPR-Cpf1

    Type
    Blog Post
    ... Cpf1 for multiplex genome editing.  For a few reasons, Cpf1 is a simplified system for editing multiple...guide page for a review of Cas9.  For a brief comparison of Cpf1 vs. Cas9, see the table below. Table...expression vector.  See the graph in figure 2 for a comparison of editing frequency resulting from transfection...
  36. Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers

    Type
    Blog Post
    ... the genome. Mendenhall and Richard Myers of HudsonAlpha (where Mendenhall is also an adjunct faculty ...the function of the protein. Myers: We’ve done comparisons of our new system versus standard ChIP-seq for... for transcription factors, but there are many reasons you might want a system like this. It’s actually...
  37. CRISPR 101: Non-Homologous End Joining

    Type
    Blog Post
    ... Renaud J-B, Sallmyr A, Ruis B, Oh S, Tomkinson AE, Hendrickson EA, Giovannangeli C, Jasin M, Brunet E...P, Burkhalter MD, Oh S, Qaqish BF, Moore DT, Hendrickson EA, Ramsden DA (2014) The fidelity of the ligation...
  38. Form Your Own Peer Mentoring Group: A How-To Guide for Scientists

    Type
    Blog Post
    ...want to cover during the year. Suggest that each person bring 3 topics and write them on a board to see... and meet regularly no matter what, even if one person can’t make it. One of the biggest group mentoring...meetings. Experiment with the process. Have each person write a Development Plan. Set concrete goals with...
  39. Will You Be My Mentor? Finding and Asking for Mentoring Support

    Type
    Blog Post
    ... on what makes them that way. Is there a senior person whose career path you are interested in following.... Finding potential mentors is one of the many reasons to always be growing your network. If you don’t...need for your current position Understand your interpersonal challenges if they know some of the people you...
  40. Kiran Musunuru on the Newest TALEN Genome-Editing System

    Type
    Blog Post
    ...decades to generate knock-out mice, but for various reasons it is not nearly as efficient in human stem cells...genetic background and do an apples-to-apples comparison of all those mutations. If you make induced pluripotent...backgrounds. It becomes more of an apples-to-oranges comparison. Addgene: Can you compare the TALEN kit to CRISPR...
  41. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...trans-splicing or overlapping vectors: a quantitative comparison . Molecular Therapy, 4 (4), 383–391. https://...
  42. To Each HIS Own

    Type
    Blog Post
    ...Abrahrnsen L, Oesterlof B, Josephson S, Oestling M, Enfors SO, Persson I, Nilsson B and Uhlen M. Large-scale...
  43. Plasmids 101: CcdB - The Toxic Key to Efficient Cloning

    Type
    Blog Post
    ...ligase-mediated method, the more recently developed Gibson Assembly Cloning and Gateway® cloning technologies... toxic protein (CcdB) that acts as a DNA gyrase poison, locking up DNA gyrase with broken double stranded...killing by the F plasmid CcdB protein involves poisoning of DNA-topoisomerase II complexes.” J Mol Biol...
  44. Corralling and Cornering the Goldilocks Antibody

    Type
    Blog Post
    ... both NeuroMab and the Allen Brain Atlas. The comparison with two atlases enables us to see the reproducibility...literature suggest, providing an expectation and comparison on the antibody signal’s location. If a distinct... discuss the results together, explaining our reasoning to determine if the antibody is negative (poor...
  45. A Look Back at One Year of Plasmid Sharing for COVID-19 Research

    Type
    Blog Post
    ...spike protein, called HexoPro, was developed by Jason McLellan’s lab. This version of the spike protein... Lee AG, Liu Y, Chou C-W, Byrne PO, Hjorth CK, Johnson NV, Ludes-Meyers J, Nguyen AW, Park J, Wang N, ...Seaman MS, Schmidt AG, Chen B, Neuberg D, Bajic G, Harrison SC, Wesemann DR (2021) Memory B cell repertoire...
Showing: 251 - 300 of 740 results