Skip to main content

We narrowed to 527 results for: HA tag

Showing: 101 - 120 of 527 results
  1. Choosing the B(right)est Fluorescent Protein: Aggregation Tendency

    Type
    Blog Post
    ...conclude that mKOk has dimerization tendency and is not suitable for protein tagging. On the other hand...guarantee that using this fluorescent protein to tag your protein of interest will be problem-free. In...of different fluorescent proteins when protein tagging is the goal (Cranfill et al, 2016; Constantini ...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse...analytical ultracentrifugation yields an affinity and has been used to demonstrate that yellow fluorescent ... cells. Strikingly, the OSER assay reveals that tagRFP does not act as a true monomer in cells (Constantini...
  2. A Practical Approach to Choosing the B(right)est Fluorescent Protein

    Type
    Blog Post
    ...cellular variation observed in mammalian cells is to tag an endogenous gene. By imaging cells (or tissues)...tissues) that produce an endogenous protein tagged with a fluorescent protein and repeating this with another...co-expressing fluorescent proteins or using endogenous tagged genes) can be used to verify performance under ...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse...well or cannot be detected in a microscopy setup has zero practical brightness and is of no use. Therefore... practical brightness can be made. This strategy has been used in yeast by Lee et al (2013) and in nematodes...
  3. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

    Type
    Blog Post
    ...which attaches a Myc-tag and a His6-tag to the end of each sybody candidate. These tags are used in a final...selection step using ribosome display because it has the advantage of starting out with a larger initial starting...antibodies bound to an ELISA plate to capture Myc-tagged sybodies. Then, the biotinylated target protein...pBXNPHM3 expression plasmids for the production of tag-free proteins for further characterization and analysis... inhibit these viruses.  But llama immunization has its drawbacks: it requires a camelid animal facility...Walter et al., 2020). No llamas required. The advantages of synthetic nanobodies Nanobodies are small ...
  4. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...GFP for a wide number of functions, including: tagging genes for elucidating their expression or localization...technology is constantly being developed! Fusion tagging: One of the most common uses, GFP can be fused ...Purification: GFP can be used as a general epitope tag for protein purification and a number of commercial...proteins such as Green Fluorescent Protein (GFP) has likely existed in creatures such as jellyfish for...from the crystal jellyfish Aequorea victoria. It has a fluorescent emission wavelength in the green portion...protein isolated from Discosoma sp. Similar work has been done to expand the red-fluorescent protein repertoire.... Split EGFP: An alternative to FRET, split EGFP has also been used to study protein-protein interactions...
  5. Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards

    Type
    Blog Post
    ...calcium, and membrane voltage,” says Tian. Figure 5: Citrine-tagged voltage indicator expressed ...they occur.  First, she used a genetic method to tag neurons activated by opioid withdrawal with tdTomato...neuron (via hM4D). She fused fluorescent protein tags to the receptors to monitor their localization and...developing and optimizing biosensors in the lab. He has recently developed a third-generation intensiometric...release from hundreds of synapses at once. “This work has only been made possible due to the collaborative ... at the German Cancer Research Center (DKFZ) who has developed new redox sensitive GFP2 (roGFP2)-based...Qiu’s work on the PV neurons is in progress, she has validated the dual virus method to study CR neurons...
  6. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...cytoskeleton or blocking membrane trafficking. Addgene has assembled a collection of fluorescent fusion proteins...protein of interest with a fluorescent protein that has a different emission wavelength. For example, if ...mScarlet-I Dorus Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson...EEA1 GFP Silvia Corvera 42635 TagRFP-T-EEA1 Early endosomes EEA1 TagRFP-T Silvia Corvera 38770 pEF.myc.ER-E2...
  7. Retrograde AAV viral preps

    Type
    Collection
    ...105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases James M. Wilson 105551...pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases James M. Wilson 105553...Activator DREADD Bryan Roth 121539 pOTTC1596 - pAAV SYN1 HA-hM3D(Gq) Syn Activator DREADD Christopher Richie ...See our retrograde AAV based on the functional catagories listed below. Narrow down the items available...
  8. Google Forums Round Up: First Impressions of NgAgo

    Type
    Blog Post
    ...technique for epitope tagging but only one of them could detect knock-in of tags at a target site. Overall...epitope tagging). NgAgo survey Since it was first published in Nat Biotech in May 2016 (1), NgAgo has received...THE ORIGINAL NgAgo ARTICLE DISCUSSED IN THIS POST HAS BEEN RETRACTED AND FOLLOW UP STUDIES HAVE FAILED ...spotlight and take a moment to remember that NgAgo has only been available for genome editing for a few ... synthesis, which could be less desirable if one has to target multiple sites in a single experiment. ...received much attention and the plasmid has been requested by labs around the globe nearly 400 times. Researchers...functional tests. The newest genome engineer sharing the stage with much-lauded CRISPR-Cas9 is DNA-guided endonuclease...
  9. Anatomy of a Plasmid Page at Addgene

    Type
    Blog Post
    ...empty vector with a tag, it’s terminus will be listed as the most likely terminus the tag will end up on after...its own gene/insert section on the plasmid page. Tags are listed according to whether they’ll end up on...popularity. A yellow flame indicates that a plasmid has been ordered more than 20 times; red, more than 50...available through Addgene. Publication: If the plasmid has been published, the paper in which it was first used... their new plasmid.  The Addgene Vector Database has more information about common vector backbones.  ...plasmid number here. Gene/insert: This describes what has been inserted into the backbone, and provides information...gene or DNA element of interest. If the depositor has indicated that there is a particular mutation found...
  10. Tips for Using FRET in Your Experiments

    Type
    Blog Post
    ...Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses mammalian optimized...Cyan Bacterial Expresses CyPet with C-terminal His tag SCFP3A Cyan Mammalian Express a gene of interest...Yellow Bacterial Expresses YPet with C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest... in situ. Used since the mid-90s, this technique has revolutionised the way we apprehend molecular complexes...protein interactions in living cells. Since then FRET has also been used to measure conformational changes,...brightness - even though in the most popular pair, CFP has five-fold less brightness than YFP. The stoichiometry...Fluorescence lifetime imaging microscopy method FLIM has been developed more recently and is the most rigorous...
  11. Hot Plasmids September 2018 - Optogenetics, RNA Localization, Fluorescent Protein, and Base-editing Tools

    Type
    Blog Post
    ...These new “Riboglow” probes contain a smaller RNA tag, are less prone to photobleaching, and achieve better...compared to imaging with broccoli aptamers or MS2 tags using the same number of fluorophores. You can find... dark but dissociate under blue light. This tool has now been modified by Torsten Wittmann’s lab at UCSF...genetic or pharmacological manipulations on cells, and has potential use for a wide range of applications in...monomeric, 4-5 fold brighter than mNeptune684, and has a favorable pKa of 5.6. To test out this new FP in...The increasing popularity of single base-editors has resulted in the rapid expansion of the genome editing...expansion of genome editing tools, the Reuben Harris lab has deposited a reporter plasmid that allows for rapid...
  12. Multiplexed Capture of Promoter-enhancer 3D Chromatin Structures Using CRISPR

    Type
    Blog Post
    ... Replace the biotinalatable tag on dCas9 with a BioTAP-tag. The BioTAP-tag is a 69 aa long biotinylation... lentiviruses delivering 1) a BioTAP-tagged dCas9 and an eGFP tag, and 2) gRNAs Number of loci targeted...normally expressed in eukaryotic cells. Using this tag reduces the number of CAPTURE components that need...from three to two. Lentiviral delivery of BioTAP-tagged dCas9 and gRNAs. Using lentiviral delivery of the...system Stable cell line expressing 1) FLAG-biotin-tagged dCas9, 2) BirA, and 3) one or more gRNAs Two separate... original CAPTURE method is that a new cell line has to be created for each genomic loci of interest. ...
  13. Hot Plasmids: Summer 2025

    Type
    Blog Post
    ...presynaptic vesicle protein (VAMP2) and an epitope tag (ALFA-tag, or At) for easy visualization. A cleavage site...CRISPR has become a household name, the search for smaller genome editors is heating up and TnpB has found... of ATLASCre. VAMP2 = synaptobrevin 2; At = ALFA-tag; BACE = β-secretase; AF = AMPA.FingR; FingR = fibronectin...planning on lounging poolside or swimming laps, Addgene has pooled libraries for any summer project. While many...neurons. Created with BioRender.com. Addgene has tested these capsid plasmids in vitro and uses them...
  14. Retrovirus Plasmids

    Type
    Collection
    ... expresses GFP. Also see pMIG-w , a variant that has WRE, a post-transcriptional regulatory element that...results in long-term transgene expression. Some disadvantages of γ-retroviruses are that they can only transduce... can lead to oncogenesis (termed insertional mutagenesis). Read our γ-Retrovirus Guide for more information...
  15. AAV for Neuronal Tracing

    Type
    Collection
    ... delivery by an AAV. Since this starter cell now has all the viral genes present, the virus can spread...virus AAV1 Ian Wickersham 100799 pAAV-TREtight-mTagBFP2-B19G AAV1 Ian Wickersham Introduction to Rabies...
  16. Deck the Lab 2022!

    Type
    Blog Post
    ...Twitter or Instagram by December 31, 2022.  Follow @Addgene, use the hashtag #DeckTheLab, and tag @Addgene...and then share them on Twitter or Instagram with #DeckTheLab and tagging us, @addgene to be judged! In ...this post on Instagram                     A post shared by Xi Chen (@seleena78) The lab has officially...December 12, 2022          View this post on Instagram                     A post shared by 草方 (@gracie_fang...get you out of.           View this post on Instagram                     A post shared by Xi Chen...and reveal the winning entries on Twitter and Instagram! Happy decorating, all, and to all a good light...
  17. Sequencing Primers

    Type
    Guide
    ...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...
  18. Hot Plasmids and Viral Preps - May 2021

    Type
    Blog Post
    ...GFP to enhance axonal labeling and synaptophysin-tagged mRuby to enrich pre-synaptic labeling. Now available...tdTomato and pre-synaptic targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE...a ready-to-use AAV5 viral vector. Synaptophysin-tagged GCaMP6s is enriched in the pre-synaptic terminal...pathways By Gabrielle Clouse Claudia Vickers’ lab has created a novel nanocompartment for transporting ...Staphylococcus lugdunensis that recognizes a NNGG PAM and has comparable activity to SaCas9. A new yeast inducible...that is smaller and easier to deliver, but so far has few inhibitors identified.     New from the viral...
  19. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...CFP, or YFP fluorescence. In Brainbow 2.1, GFP is tagged with a nuclear localization sequence, allowing ...developed a version of Tetbow that incorporates chemical tags instead of XFP to optimize it for tissue clearing...architecture of a fluorescent neuron is visible. Chemical tags are more resistant to tissue clearing methods and... circuits with fluorescent proteins and chemical tags." eLife 7 (2018): e40350. PubMed PMID: 30454553....track single cell dynamics at the organism level has been made possible by tools that allow cells to become... such as neurons in the fly visual system, which has been difficult to study previously (Hadjieconomou...of cells in the intestinal crypt, and since then has become a powerful tool for understanding cell proliferation...
Showing: 101 - 120 of 527 results