We narrowed to 526 results for: HA tag

...technique for epitope tagging but only one of them could detect knock-in of tags at a target site. Overall...epitope tagging). NgAgo survey Since it was first published in Nat Biotech in May 2016 (1), NgAgo has received...THE ORIGINAL NgAgo ARTICLE DISCUSSED IN THIS POST HAS BEEN RETRACTED AND FOLLOW UP STUDIES HAVE FAILED ...spotlight and take a moment to remember that NgAgo has only been available for genome editing for a few ... synthesis, which could be less desirable if one has to target multiple sites in a single experiment. ...received much attention and the plasmid has been requested by labs around the globe nearly 400 times. Researchers...functional tests. The newest genome engineer sharing the stage with much-lauded CRISPR-Cas9 is DNA-guided endonuclease...

...empty vector with a tag, it’s terminus will be listed as the most likely terminus the tag will end up on after...its own gene/insert section on the plasmid page. Tags are listed according to whether they’ll end up on...popularity. A yellow flame indicates that a plasmid has been ordered more than 20 times; red, more than 50...available through Addgene. Publication: If the plasmid has been published, the paper in which it was first used... their new plasmid.  The Addgene Vector Database has more information about common vector backbones.  ...plasmid number here. Gene/insert: This describes what has been inserted into the backbone, and provides information...gene or DNA element of interest. If the depositor has indicated that there is a particular mutation found...

...Addgene has a growing collection of plasmids that are available to industry. Learn more about the available... it with your organization. If your organization has not ordered from Addgene in the past, we will need...regarding your account verification. Once your account has been verified, you will be able to place your order...our Help Center . The MTA Process: Once your order has been placed on our website, Addgene will email you...behalf of the recipient institution. Once the MTA has been signed, it can be submitted to Addgene through...Information Featured Collections NEW NanoLuc and HaloTag Fusions from Promega COVID-19 SARS-COV-2, ACE2,...

...Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses mammalian optimized...Cyan Bacterial Expresses CyPet with C-terminal His tag SCFP3A Cyan Mammalian Express a gene of interest...Yellow Bacterial Expresses YPet with C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest... in situ. Used since the mid-90s, this technique has revolutionised the way we apprehend molecular complexes...protein interactions in living cells. Since then FRET has also been used to measure conformational changes,...brightness - even though in the most popular pair, CFP has five-fold less brightness than YFP. The stoichiometry...Fluorescence lifetime imaging microscopy method FLIM has been developed more recently and is the most rigorous...

...directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...

...HiBiT tagging technology.   The bioluminescence advantage There are countless protein tags floating...the native function of tagged proteins and facilitates precise CRISPR-based tagging, or low-levels of ectopic...HiBiT tag to provide complementary validation of protein expression and localization. HiBiT-tagged targets...true biology. Fluorescent fusions utilizing bulky tags can disrupt normal cell biology and make it hard... (Tsien, 1998). What sets HiBiT apart from these tags is its use of bioluminescence to reflect protein...whether the authors incorporated HiBiT by CRISPR tagging at the endogenous locus or used other expression...responses (Kamio et al., 2025). They designed HiBiT-tagged TP53 constructs, one with an R175H mutation to ...

...These new “Riboglow” probes contain a smaller RNA tag, are less prone to photobleaching, and achieve better...compared to imaging with broccoli aptamers or MS2 tags using the same number of fluorophores. You can find... dark but dissociate under blue light. This tool has now been modified by Torsten Wittmann’s lab at UCSF...genetic or pharmacological manipulations on cells, and has potential use for a wide range of applications in...monomeric, 4-5 fold brighter than mNeptune684, and has a favorable pKa of 5.6. To test out this new FP in...The increasing popularity of single base-editors has resulted in the rapid expansion of the genome editing...expansion of genome editing tools, the Reuben Harris lab has deposited a reporter plasmid that allows for rapid...

... Replace the biotinalatable tag on dCas9 with a BioTAP-tag. The BioTAP-tag is a 69 aa long biotinylation... lentiviruses delivering 1) a BioTAP-tagged dCas9 and an eGFP tag, and 2) gRNAs Number of loci targeted...normally expressed in eukaryotic cells. Using this tag reduces the number of CAPTURE components that need...from three to two. Lentiviral delivery of BioTAP-tagged dCas9 and gRNAs. Using lentiviral delivery of the...system Stable cell line expressing 1) FLAG-biotin-tagged dCas9, 2) BirA, and 3) one or more gRNAs Two separate... original CAPTURE method is that a new cell line has to be created for each genomic loci of interest. ...

...brain and muscle development. The Gronostajski lab has generated mice wherein it's possible to delete the...research on diseases of glycosylation, arginine mutagenesis, and neural development. Paula Videira: Congenital...as reporters of NFIX function. They will then mutagenize the NFIX gene and test whether variants of unknown...

...presynaptic vesicle protein (VAMP2) and an epitope tag (ALFA-tag, or At) for easy visualization. A cleavage site...CRISPR has become a household name, the search for smaller genome editors is heating up and TnpB has found... of ATLASCre. VAMP2 = synaptobrevin 2; At = ALFA-tag; BACE = β-secretase; AF = AMPA.FingR; FingR = fibronectin...planning on lounging poolside or swimming laps, Addgene has pooled libraries for any summer project. While many...neurons. Created with BioRender.com. Addgene has tested these capsid plasmids in vitro and uses them...

...promoter Forward HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin...sequencing (NGS) for plasmid verification, Addgene has used a number of primers for Sanger sequence verification...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...

...Twitter or Instagram by December 31, 2022.  Follow @Addgene, use the hashtag #DeckTheLab, and tag @Addgene...and then share them on Twitter or Instagram with #DeckTheLab and tagging us, @addgene to be judged! In ...this post on Instagram                     A post shared by Xi Chen (@seleena78) The lab has officially...December 12, 2022          View this post on Instagram                     A post shared by 草方 (@gracie_fang...get you out of.           View this post on Instagram                     A post shared by Xi Chen...and reveal the winning entries on Twitter and Instagram! Happy decorating, all, and to all a good light...

...GFP to enhance axonal labeling and synaptophysin-tagged mRuby to enrich pre-synaptic labeling. Now available...tdTomato and pre-synaptic targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE...a ready-to-use AAV5 viral vector. Synaptophysin-tagged GCaMP6s is enriched in the pre-synaptic terminal...pathways By Gabrielle Clouse Claudia Vickers’ lab has created a novel nanocompartment for transporting ...Staphylococcus lugdunensis that recognizes a NNGG PAM and has comparable activity to SaCas9. A new yeast inducible...that is smaller and easier to deliver, but so far has few inhibitors identified.     New from the viral...

...CFP, or YFP fluorescence. In Brainbow 2.1, GFP is tagged with a nuclear localization sequence, allowing ...developed a version of Tetbow that incorporates chemical tags instead of XFP to optimize it for tissue clearing...architecture of a fluorescent neuron is visible. Chemical tags are more resistant to tissue clearing methods and... circuits with fluorescent proteins and chemical tags." eLife 7 (2018): e40350. PubMed PMID: 30454553....track single cell dynamics at the organism level has been made possible by tools that allow cells to become... such as neurons in the fly visual system, which has been difficult to study previously (Hadjieconomou...of cells in the intestinal crypt, and since then has become a powerful tool for understanding cell proliferation...

...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...DNA-binding protein has some flexibility in the recognition sequence. Epitope tags, on the other hand,...random incorporation of modified, fluorescently-tagged bases during in vitro DNA replication in addition...nucleotides. The four standard bases (dNTPs) are tagged with a different fluorophore so they can be distinguished...distinguished from one another. These tagged dNTPs also lack a binding site for the next nucleotide (denoted...because the ultimate goal is to have a fluorescently-tagged nucleotide at each position in the DNA sequence...Like Sanger, NGS utilizes modified, fluorescently-tagged nucleotides. During Illumina NGS, a long piece ...

...generated plasmids tagged with EB3 to mark the growing tips of microtubuli and plasmids tagged with MapTau to... the desired nanobody (NB) sequence, an AviTAG, and 6xHis tag. The MBP signal peptide allows the NB to...sequence-specific protease used to cleave affinity tags from purified recombinant proteins at small and ...cells were transfected with plasmids encoding FPs tagged with the plasma membrane targetin sequence derived...improved genetically encoded fluorescent markers tagged with mTurquoise2, mNeonGreen, and mScarlet-I for...with low affinity variants of TEV. The new system has been demonstrated to work for evolution of other ...commonly used for in vivo biotinylation via BirA and AviTAG. pMAK contains the signal peptide of MBP, followed...

...affinity to fluorophores. Examples are the FlAsH tag, the His tag and several others. Another peptide-based ...when selecting a genetically encoded fluorescent tag. There are, however, a number of limitations that...binding proteins as described above. The smallest tags are peptides that are engineered to bind specifically...systems are a hybrid between a genetically encoded tag and exogenously added components. For a review see...Hilaire et al., 2017). GFP can only be used for tagging proteins GFP fusion proteins are made by connecting...5. Thorn, Kurt. "Genetically encoded fluorescent tags." Molecular biology of the cell 28.7 (2017): 848...: 10748019.  8. Lotze, Jonathan, et al. "Peptide-tags for site-specific protein labelling in vitro and...

...fact, NLuc is bright enough to detect endogenous tagged genes generated through CRISPR/Cas9 knock-in. Finally..., NLuc is very inviting for endogenous protein tagging as it is only 19 kDa. An example is the CRISPaint-NLuc...2016) CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nature Comm...certain experimental setups. The brightness of NLuc has caught the attention of researchers wanting to perform...proteins can be excited by Nluc emission and the lab has dubbed these fusions LumiFluor Reporters. The LumiFluor...mNeptune2 through 33 mutations and 2 deletions. CyOFP1 has a higher quantum yield, brightness and improved maturation...with Luciferases can overcome these problems but has been hampered by dim signals from the coupled luciferase...

...such as visualizing genomic loci using fluorophore tagged dCas9 may require the use of plasmid or viral-mediated...alternative approach is to express and purify His-tagged Cas9 from E. coli using a plasmid such as pET-28b-Cas9...can be used to deliver a Cas9-gRNA RNP. This advantage has allowed scientists to perform in vitro and in...figure above), are in the early stages of development. David Liu’s Lab has demonstrated the use of cationic...CRISPR has greatly enhanced the ability of scientists to make genomic alterations, bringing about a revolution...inserting a custom gRNA.  While this methodology has proven to be incredibly valuable to scientists, there...to the use of this technique in cell culture, it has also been applied to genome editing of mouse zygotes...

...plasmid.     Confirming tags and fusion proteins Finally, we confirm promoters, tags, fusion proteins, and...anyone who has ever worked to sequence DNA on NGS platforms will tell you, while the process has become much...aligning to NCBI entry or using BLAST.   Confirming tags and fusion proteins. We’ll break down each of these...