Skip to main content
Addgene
Showing: 101 - 120 of 375 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...
  2. Deep Dive: qPCR

    Type
    Blog Post
    ... or greater with good statistical significance (Taylor, 2017). With the right conditions and parameters...):332-7. doi: 10.2144/00292rv02. PMID: 10948434.Taylor SC; Laperriere G;  Germain H. Droplet Digital PCR...2017). https://doi.org/10.1038/s41598-017-02217-xTaylor, SC; Nadeau, K; Abbasi, M; Lachance, C; Nguyen,...j.tibtech.2018.12.002.Teo IA; Choi JW;  Morlese J; Taylor G; Shaun S. LightCycler qPCR optimisation for low...
  3. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...did perform similarly to GRABNE, and having both colors allows for increased options for multiplexing in...Reiner, A., … Patriarchi, T. (2023). Sensitive multicolor indicators for monitoring norepinephrine in vivo...Microscopy Technique is Best for Me?  In Living Color: The Skinny on In Vivo Imaging Tools Resources ...
  4. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... a powerful tool to modify mammalian cells. Multicolor CRISPR labeling chromosomal loci in genome Thoru... School has recently developed a CRISPR-based multicolor tool enabling the imaging of multiple endogenous...2015. PubMed PMID: 26456817. Nano-lanterns for multicolor luminescence imaging  Fluorescent imaging techniques...colleagues at Osaka University have developed two new color variants of their Nano-lantern technology, first...emission spectra suitable for single cell, multi-color imaging. The Nano-lanterns rely on the principle...monitoring multi-gene expression and adapt it for multi-color calcium sensing (plasmids coming soon!). Takai...
  5. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ...If the fall colors are inspiring you to paint your cells in equally vivid colors, you'll want to check...serotype AAV-CamKIIa-jGCaMP8s-WPRE AAV5 Biosensors Loren Looger New serotype pAAV-CAG-FLEx-iSeroSnFR AAV9...
  6. Viral Vectors 101: What is a Virus (and a Viral Vector)?

    Type
    Blog Post
    ...B978-0-12-800947-5.00004-1 Taylor, M. W. (2014). What Is a Virus? In M. W. Taylor (Ed.), Viruses and Man:...are simple: a genome packaged in a protein shell (Taylor, 2014). They’re so simple that we can’t even decide...
  7. Donations from Addgene to Yield Answers for Rare Disease Researchers

    Type
    Blog Post
    .... They’ll put a variety of plasmids to work to explore the effect of various OCRL1 mutations on cell behavior...GFP-ATP1A3, FLAG-ATP1A3, and ATP1B3 plasmids to explore the functional differences among mutations responsible...disease that can cause hearing loss and changes in coloring of the hair, skin, and eyes. The researchers found...
  8. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ...single mRNA over time. Both are helping researchers explore the complexity of translational control in cellular... and translated RNAs appear red. To enable this color switching, TRICK requires the following components...translocation rate of ~3.5 codons/second. They also explored the effects of 5’ UTR variants in translation ...
  9. The Power Behind NGS Plasmid Validation: seqWell

    Type
    Blog Post
    ...services! Many thanks to Joe Mellor, our guest writer from seqWell Inc. Joe Mellor is the Founder and CEO of...This post was contributed by guest blogger Joe Mellor, Founder and CEO of seqWell Inc. Plasmids and PCR...
  10. Celebrate National Book Month with Addgene

    Type
    Blog Post
    ... where 1000 years ago the hero lost and the Dark Lord rules all, the books center around a cast of endearing...a book club would force me to read some books exploring new genres, new authors, and new themes. A book...non-scientists. It wouldn’t matter whether you had a bachelor’s degree or a PhD, majored in Biochemistry or International...
  11. New Neuroscience Tool: The iGluSnFR3 Glutamate Sensor

    Type
    Blog Post
    ...Here, we look at the origins of the system and explore advances that have happened since our original ...of iGluSnFR   iGluSnFR was developed in 2013 by Loren Looger’s lab at HHMI Janelia Research Campus to ...affinity for glutamate), that came in three different colors – blue (SF-Azurite-iGluSnFR), green (SF-iGluSnFR...
  12. A Deep Dive into BioBuilder

    Type
    Blog Post
    ...BioBuilder embraces new opportunities for scientific exploration, discovery, and collaboration. One module currently...and the new BioBuilder module allows students to explore how engineering fields rely on rapid prototyping...the lab as a starting point into further STEM exploration.  Further offerings for both STEM teachers and...
  13. Rosella: A Fluorescent pH-Biosensor for Studying Autophagy

    Type
    Blog Post
    ...Rosella fluorescent properties Rosella is a dual color-emission biosensor named after the brightly-coloured... or lysosome. See Table 2 for a summary of what color fluorescence Rosella emits based on its localization...fluorescence emission. Localization pH Emission Color Cytosol ~7.5 Red and Green Mitochondria ~...
  14. Antibodies 101: Conjugation

    Type
    Blog Post
    ...antibodies that produce detectable signals like light or color. In this post, we’ll go over some of the common ...blots and ELISAs. Chromogenic reactions produce a color change, so they are typically used in microscopy-based...filtration.    There is, of course, a lot more to explore in the world of antibody conjugation. But hopefully...
  15. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...all the plasmids from the associated paper:   Color Base FP Description Article PI Blue EBFP2 EBFP2...ratiometric BiFC from Christopher Grefen’s lab or explore the MoBiFC modular bimolecular fluorescence complementation...(split HaloTag) provides maximum flexibility in color labeling with exogenous fluorophores, which can ...
  16. Savvy Advocates Needed to Navigate a Scientific Enterprise in Flux

    Type
    Blog Post
    ...over the past 2 years (Alberts et al, PNAS 2014; Taylor, eLife, 2016). Several Future of Research (FoR)...solutions. The 2015 Boston FoR meeting was designed to explore areas where further data is necessary to determine... 24733905. Pubmed Central PMCID: PMC4000813. 2. Taylor, Justin Q., et al. “Avoiding a lost generation ...
  17. Reaching out to China: Canton Nucleic Acids Forum (CNAF) 2015

    Type
    Blog Post
    ...some cases I couldn’t tell if the bags contained flora or fauna. I tried to find out what certain ingredients...and more are being reported. Zhou Songyang from Baylor College of Medicine and Sun Yat-sen University ...cas9 inducible knock-out system. His lab is also exploring the use of cas9 proteins from different species...
Showing: 101 - 120 of 375 results