We narrowed to 742 results for: SON;

...proteins on the cell surface. Figure 1: Comparison of common antibody, HCab, and nanobody. For more...starting library size (up to 1012 members) in comparison to other display systems using phage and yeast...Egloff P, Hutter CAJ, Kuhn BT, Bräuer P, Newstead S, Dawson RJP, Geertsma ER, Seeger MA (2020) Generation of... Gera J, Gmür S, Spies P, Gygax D, Geertsma ER, Dawson RJ, Seeger MA (2018) Synthetic single domain antibodies...

...PMID: 31891733. Brechmann NA, Schwarz H, Eriksson PO, Eriksson K, Shokri A, Chotteau V. Antibody capture....106. PMID: 33151027; PMCID: PMC7665837. L'Abbé D, Bisson L, Gervais C, Grazzini E, Durocher Y. Transient...Chen E, Haidar JN, Srivastava A, Goldstein J. Comparison of predicted extinction coefficients of monoclonal...

... yet retroviruses are RNA-containing viruses  (Robinson et al., 1965)! You may be beginning to realize...Brian O'Neill, with thanks to Addgenie Rebecca Hutcheson for her assistance with lentiviral replication...PMID: 26225354. PubMed Central PMCID: PMC4515362 Robinson, W. S., Pitkanen, A., & Rubin, H. (1965). The ... PMCID: PMC355630 Faras, A. J., Taylor, J. M., Levinson, W. E., Goodman, H. M., & Bishop, J. M. (1973)...

...the most successful scientists have outgoing personalities to supplement their intellectual prowess and... era of social media and self-promotion, and personality is playing an increasingly important role in ... that produced by the confident and flamboyant Watsons.” In Part Four, “New Science,” Zimmer tackles more...little bit about many different things (part of the reason Addgene has been such a great fit for me!), the...

...identify it as a personal strength until it is identified by another person. Similar reasoning may also apply...convey your empathy and your awesome solution to the person over email. Examine your current and past job ...

...maximise the time you are enjoying both work and personal life. There are no easy answers to negotiating...my colleagues and me. To that end, here are my personal 10 commandments for making it all work – most ...the “jobs” that take you away from having your personal time. Someone else can clean your house, pick ...you can’t make it to dinner this week. One swim lesson missed can mean a world of mental relaxation. And...

...GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat...Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria transposon Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA ...

...restraining further replication.   Figure 3: Comparison of replication regulation mechanisms of stringently...regulation! This post was originally written by Jason Niehaus in December 2015 and was updated by Emily...464.1998 Grimwade, J. E., Rozgaja, T. A., Gupta, R., Dyson, K., Rao, P., & Leonard, A. C. (2018). Origin recognition.../doi.org/10.1093/nar/gky457 Park, K., Han, E., Paulsson, J., & Chattoraj, D. K. (2001). Origin pairing...

...10.1038/nature09523  Ibraheim R, Song C-Q, Mir A, Amrani N, Xue W, Sontheimer EJ (2018) All-in-one adeno-associated...can be turned off by anti-CRISPR proteins. The Sontheimer lab used NmeCas9 with AAV to edit two different...0  Kim E, Koo T, Park SW, Kim D, Kim K, Cho H-Y, Song DW, Lee KJ, Jung MH, Kim S, Kim JH, Kim JH, Kim ...

...relevant to you. Elect a devil’s advocate. This is the person whose job it is to disagree with the group. They...sure we have all experienced a meeting where one person speaks up after a group consensus and is immediately...entire company. It is important to note that the person who submitted the idea did not have to be in charge...always done it this other way,” you probably have reason to continue advocating for your idea. Our product...

...fluorescent biosensors. Aptabeacons Fluorescence resonance energy transfer (FRET) technology has been studied... sensitive detection assay. In 1999, Grate and Wilson paired laser cleavage and an RNA aptamer that bound... May 15;26(9):3725-36. PubMed PMID: 21419619. 9. Song, Kyung-Mi, et al. “Aptamers and Their Biological... 22368488. PubMed Central PMCID: PMC3279232. 10. Song, Shiping, et al. “Aptamer-based biosensors.” TrAC...

...biologist some time… months, in fact. In the Lee-Parsons lab, we are investigating how the production of...protein of interest. Find all plasmids from the Lee-Parsons lab. Test different leaf infiltration methods ...(Germany), before starting his work in the Lee-Parsons Lab.     References D'Aoust, Marc-André, et al.... De Ruijter, N. C. A., et al. "Evaluation and comparison of the GUS, LUC and GFP reporter system for gene...

...host tropism of your virus, there are many other reasons when you might pseudotype your virus:  Lowering...a cell surface to endocytose into the cell. The reason VSV-G is so commonly used is that it is good at...Sandoval, 2017). This high titer is one of the reasons VSV-G is used to transduce stem cells and neurons...https://doi.org/10.1093/hmg/10.19.2109 Sandrin V, Boson B, Salmon P, Gay W, Nègre D, Le Grand R, Trono ...

...progeny are produced (Figure 1).  Figure 1: Comparison of the life cycle of a lentiviral vector with...integrase-deficient lentiviral vectors? There are several reasons why you might choose an IDLV over a lentiviral ...This blog post was written by Addgenie Rebecca Hutcheson.   References and resources References Banasik...PMC2835240 Wu Y. (2004). HIV-1 gene expression: lessons from provirus and non-integrated DNA. Retrovirology...

... make the best case for your candidacy. A major reason that a lot of candidates either get no interviews...understand your cover letter and research statement. My personal litmus test was whether my wife could explain ... please introduce yourself to me by email or in person. If you feel compelled to repay me in some way,...job searches. If you feel the urge to repay me personally, I will gratefully accept a very hoppy pint of...

...believe GMOs are safe for human consumption in comparison to 37% of the general public (5, 6). Similarly... the public (8–13). Facing the possibility that reason is losing ground in public discourse, many scientists...politicians to interpret it for them. Other popular reasons to march include: General inclusion of science...policy should have more weight than how any one person feels about it. And yet research shows that thoughts...

...fellow at the Morgridge Institute for Research in Madison, Wisconsin. It is commonly cited that approximately...enzyme function, protein interaction, etc. by comparison to non-phosphorylated or ‘wild type’ control ...dephosphorylation reaction can be tracked through the comparison of phospho:non-phospho species on PhosTag gels...fellow at the Morgridge Institute for Research in Madison, Wisconsin. She is particularly interested in the...

...nuclear- or DNA-binding proteins, you may need to sonicate your lysates in order to release the proteins ...you’re using chemical blockers, you can run a comparison of different formulations instead of concentrations...temperature, and/or buffer to increase lysis Add sonication step to protein lysis Splice variants Check...lysing buffer/adjust lysing buffer strength Sonication based lysing protocol Subcellular fractional...  Rachel Leeson...

...Addgene. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA...publication at Addgene. Maeder ML, Angstman JF, Richardson ME, Linder SJ, Cascio VM, Tsai SQ, Ho QH, Sander...Sander JD, Reyon D, Bernstein BE, Costello JF, Wilkinson MF, Joung JK (2013) Targeted DNA demethylation... this publication at Addgene. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein...

...Single-chain variable fragment (ScFv) Figure 2: Comparison between the IgG antibody and scFv. Because...Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies are the...10.1016/j.ymeth.2017.01.009 Crivianu-Gaita V, Thompson M (2016) Aptamers, antibody scFv, and antibody...antibody Fab’ fragments: An overview and comparison of three of the most versatile biosensor biorecognition ...

...Many thanks to our guest blogger, Doug Richardson! Doug Richardson is the Director of the Harvard Center...This post was contributed by Doug Richardson, Director of the Harvard Center for Biological Imaging and... 2, 932-940 (2005). PubMed PMID: 16299478. 9. Richardson DS, Lichtman JW. Clarifying Tissue Clearing. ...

... work, funding for science, and numerous other reasons. It is important to remember that we, scientists...Albany, NY, USA 42.6526°N 73.7562°W – Nicholas Thompson Over the last few years, there's been a disturbing...positive event that I hope happens again. Nicholas Thompson is a PhD Candidate studying Nuclear Science and...enforcement, and, although there was at least one person vocally protesting us, he was not threatening in...

... appear within a range of wavelengths. For that reason, we speak of excitation and emission spectra. Both... happens due to a process called Fluorescence Resonance Energy Transfer (FRET).   Figure 1: Emission...fused to CD45, but is separately expressed. (The reason for having a separately expressed transduction ...difficult. I chose BV421 for the following two reasons: 1) The emission spectrum of BV421 is far enough...

... something is working for you, then there is no reason to change it. But what if a kit isn’t working for...variety of manufacturers. It also includes a rough comparison of list price between these manufacturers, as...kits before deciding which one to buy. Table 3: Comparison of popular plasmid purification kit options ...blog post was written by Ashley Waldron, Hannah Dotson, and Nyla Naim. Resources Additional resources...

...for near-freezing temperatures, our first of the season snow flurries, dusting off the winter coats and... to #DeckTheLab with virus snowflakes from @CVRHutchinson #SciArt #STEAM #WinterWonderlab @Addgene Make...WFH space feel a little more festive this holiday season! It is that time of the year again: miniature ...

...Serotype Category Depositor  Notes pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE AAV1, AAV5 Optogenetics...Biosensors Li New viral service pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG...resources!   This blog post was written by Rachel Leeson and Brian O'Neill.  More resources on the Addgene...

...vivo T cell Screens (FITS) approach (Milling and Markson et al., 2024), developed and deposited at Addgene.... Figure used with permission from Milling and Markson et al., 2024.   Proof of concept The FITS approach...cancer.   References and resources Milling, L. E., Markson, S. C., Tjokrosurjo, Q., Derosia, N. M., Streeter...

...PHP.eB Controls Wilson New viral vector pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype... Rachel Leeson...

...description of the tasks I would be responsible for, in comparison to the other positions listed with a much less...flexibility was the ability to work either remotely or in person. This was useful to me as some days it was not ...their employees are feeling comfortable.     Lucie Wilson is a rising junior and bioengineering student at...

...note that these results could be biased for two reasons: 1) they are based on the US Occupational Employment...nonscientists, blur the line between professional and personal on Twitter. Or maybe scientist prefer to share...Tips: Online Social Networking for Scientists 5 Reasons to Use Reddit for Science Communication 10 Ways...

...primers for In-Fusion Cloning Design primers for Gibson Assembly and NEB HiFi DNA Assembly  OligoAnalyzer...cloning methods, such as restriction enzyme cloning, Gibson assembly, or In-Fusion cloning.  NEB Ligation ...resources were added in September 2023 by Rachel Leeson.  Additional resources on the Addgene blog: ...

...Bioluminescence Resonance Energy Transfer (BRET). BRET is similar to Förster Resonance Energy Transfer...heterotrimeric G protein dissociation by bioluminescence resonance energy transfer 2, or BRET2. With binding of the...

...depolarization of R2 neurons using CsChrimson::tdTomato, an optogenetic tool (CsChrimson) attached to a fluorescent...Yang HH, Fisher YE, Wang IE, Ishida IG, Maimon G, Wilson RI, Clandinin TR (2019) SPARC: a method to genetically...

...mosaic virus Dr. Fiona Robertson, University of Zimbabwe, Zimbabwe Dr. Fiona Robertson (far left) is a Senior...potential for this drought tolerant plant, Dr. Robertson aims to make use of the CRISPR/Cas9 technology...

...scientific community, what other reasons do we like being a nonprofit? One big reason is that scientists and technology..., Eric, Gizela, Henry, Ina, Inna, Ishrat, Jane, Jason, Jessica, Joel, Jonathan, Justine, Karen, Kate, ...

...matters! There are important societal reasons, self-interested reasons, and, given that science is largely...largely funded by tax-payers, there are reasons to feel obligated too, as experts on the subject brought out...

... mind from that session were words from Eric Hendrickson, loosely paraphrased in the tweet below. The... DNA for Enhanced CRISPR Genome Editing Chris Richardson and members of Jacob Corn’s lab describe how ...Yinan, Brian Ruis, Taylor Takasugi, and Eric A. Hendrickson. Genome Res 27(7) (2017):1099-1111. PubMed PMID...

... cloning methods, including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may...trans-splicing or overlapping vectors: a quantitative comparison . Molecular Therapy, 4 (4), 383–391. https://...

...AAV9  pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 124603  AAV9  pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-...affect DREADD trafficking and localization. The Sternson lab recently deposited PSAM AAV, which encode ...

...visualization tools using CRISPR In 2015, Thoru Pederson’s lab at the University of Massachusetts Medical...CRISPR-Sirius Recently, Hanhui Ma and the Thoru Pederson lab developed CRISPR-Sirius (Ma et al., 2018)....order to label two loci simultaneously, Ma and Pederson created another sgRNA containing the PP7 hairpin...