Skip to main content
Addgene

We narrowed to 1,074 results for: CAN

Showing: 121 - 140 of 1074 results
  1. Immunology Research Plasmids and Resources

    Type
    Collection
    ...small proteins that can be secreted by immune cells and other cell types. They can be grouped in to the...cells will expand and give rise to memory cells that can recognize a recurrent infection and rapidly initiate...duration of signaling controls the fate of B cells and can lead to the formation of a high avidity BCR through...described. NK Cell Signaling Natural killer (NK) cells can kill cells that have been infected by a foreign pathogen...cytokines when cleaved from the cell membrane and can also function as signaling proteins involved in proliferation...
  2. Optogenetics AAV Preps

    Type
    Collection
    ...Packaging Service: Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue...
  3. The Pleiades Promoter Project

    Type
    Collection
    ... information is available for each construct and can be accessed using the links to view individual plasmid...DJ, Babyak N, Black SF, Bonaguro RJ, Brauer E, Candido TR, Castellarin M, Chen J, Chen Y, Cheng JC, Chopra...
  4. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...R-mAbs in transfected cells and their validation can be found below. With these plasmids researchers will...Antibody Plasmid Collection The following plasmids can be used to produce R-mAbs from transfected mammalian...More scFv Plasmid Collection The following plasmids can be used to produce scFvs from transfected mammalian...Nanobody Plasmid Collection The following plasmids can be used to produce nanobodies from transfected bacterial...] VGlut1 Rat Mouse IgG2a 128639 Anti-Versican [N351/23R] Versican Mouse Mouse IgG2a 128640 Anti-Pan-Ankyrin... Lgi1 Mouse Mouse IgG2a 177528 Anti-Brevican [N294A/10R] Brevican Rat Mouse IgG2a 177529 Anti-GluN1 [N308...ARHGAP4 Mouse Mouse IgG2a 190309 Anti-Brevican [N294A/6] Brevican Rat Mouse IgG2a 190311 Anti-NSD1 [N312...
  5. Validated gRNA Sequences

    Type
    Collection
    ...Validated gRNA Sequences Validated gRNA sequences can be added to this table from any peer reviewed publication...GCGGCAGAGAAGGAGGACCG 70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. ...
  6. mTOR Pathway

    Type
    Collection
    ... Cancer Research mTOR Pathway mTOR Pathway You May Also Like: Cancer Pathway ORF ...poor prognosis in many cancers, including breast, colon, ovarian, and liver cancers. mTORC1 is activated...Return to top Resources Cancer Pathway ORF Kit (Sabatini & Wood) Tackling Cancers’ Drug Resistance with ...prognosis in many cancers. Cancer...ORF Kit Ras Pathway p53 Pathway Tackling Cancers’ Drug Resistance with a New Screening Kit Background mTOR...influences cell survival and cytoskeletal organization. Cancer Impact Enhanced signaling through either mTORC1...ERK, both of which are commonly dysregulated in cancer. Loss of the tumor suppressor p53 also promotes...
  7. NETRF

    Type
    Collection
    ...carcinoid, pancreatic, and related neuroendocrine cancers. The NETRF believes that creating and maintaining... the diagnosis and treatment of neuroendocrine cancers. As such, NETRF strongly encourages its funded ...-Derived Organoids Matthew Meyerson Dana-Farber Cancer Institute Finding the Causes of Small Intestinal...Neuroendocrine Tumors Ramesh Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine...
  8. CRISPR Plasmids - Parasites

    Type
    Collection
    ...malaria), Toxoplasma (toxoplasmosis), Trypanosoma (African sleeping sickness), Cryptosporidium (cryptosporidiosis...
  9. Plasmid Collections

    Type
    Collection
    ...deposited plasmids for specific disease research areas. Cancer Research Plasmids and Resource Michael J Fox Foundation...
  10. Microbiology Resources

    Type
    Collection
    ...microbiology resources. The plasmids Addgene distributes cannot be used to reconstitute self-replicating microbes...
  11. Cancer, Inflammation and Immunity - Harnessing the Body’s Defenses to Fight Cancer

    Type
    Blog Post
    ...improved anti-cancer immunosurveillance and reduced tumor mass. Methods to study autophagy can be found here...analysed a model of hepatocellular carcinoma, a cancer which can develop from a state of chronic hepatitis ...impressive videos of these interactions (Ref 3). You can find useful tips on in vivo imaging in our Fluorescent...Blog Read Additional Cancer Blog Posts Addgene's Cancer Collection Pages Cancer and the Immune System...progressing cancers. It was inspiring to participate in the 2017 Cell Symposium on Cancer, Inflammation... findings in basic immunology, cancer-immune cell interactions, cancer immunotherapy, as well as new approaches...problem with cancer research is that it is too fragmented and focused ... to understand cancer and defeat...
  12. How to Be an Excellent Trainee

    Type
    Blog Post
    ...even if you’re an oldbe trainee!) can be pretty nerve-wracking. So how can you be the best trainee possible...relationships Training can be a very fulfilling experience; even the grumpiest of researchers can enjoy it at times...up as your most prepared, can-do self and make the most of it! So, what can you do to build a positive...’s not a mystery – there are some practices that can really help! Following best trainee practices gives... we will review the preparation and planning you can do to build a bench mentor-mentee relationship and...choosing a quality mentor, and rightfully so! They can provide you with high-level career advice, open doors...least at first) than any other one. Luckily, you can do a lot to contribute to the relationship dynamic...
  13. What Do I Do Now? Academic v. Non-Academic Career Decisions

    Type
    Blog Post
    ...available ($)—can outsource a task someone else who can do better, no grant writing Job changes can happen regularly...acceptance can be an issue in getting promoted (especially race and gender) Interpersonal issues can create...specific skills <- Can move between the two (helps to know the right people) -> How can you make a decision... nonprofit science. No one list can ever encompass them all. We can’t designate non-academic jobs as “...implicit aspects of today’s postdoctoral training can directly interfere with a seamless jump into industry...non-academic careers in science have in common? You can do quality science on interesting topics Having strong...journals is absolutely necessary for success One can experience a greater sense of autonomy - there are...
  14. Plasmids 101: Transformation, Transduction, Bacterial Conjugation, and Transfection

    Type
    Blog Post
    ...membrane so the bacteria can easily uptake your plasmid of interest. Scientists can also use electroporation...infected bacterium can either exist as transient extrachromosomal DNA, like a plasmid, or it can integrate into...lines. This can be done with lentiviral and Adeno Associated Viruses (AAV). Lentiviral and AAV can be used...scientific research. There are multiple ways foreign DNA can be introduced into cells including transformation...material often comes from adjacent lysed bacteria and can include plasmid DNA or fragmented DNA released into...bacteria are naturally competent to take up DNA, they can be made competent through chemical manipulation in...bacterium uptakes a plasmid, the genes on the plasmid can give them different phenotypes. For example, this...
  15. Antibodies 101: Beyond Surface Labeling

    Type
    Blog Post
    ...application, they can be membrane-permeant or membrane-impermeant, and the cells of interest can be the ones...dye staining can be done on live cells. For cellular proliferation, esterified dyes that can enter cells...in the extracellular space. The targeted epitopes can be motifs within transmembrane proteins, such as ...However, there are more techniques and strategies one can employ beyond simply incubating cells with single-fluorophore-conjugated...single-fluorophore-conjugated antibodies. These methods can include labeling markers with multiple proteins/antibodies...visualizing DNA instead of proteins. Some stains can diffuse through the cell membrane freely, while others... application, one or several of those techniques can be used alongside standard surface labels. Here, ...
  16. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...cells: antibodies can bind to proteins on the cell surface, or the cell membrane can be permeabilized ...natural part of the immune system and a tool that can be used for a variety of research applications. Within... immune system is referred to as an antigen. You can learn more about antibodies in our Antibodies 101...Once a protein is targeted with an antibody, you can visualize the protein via fluorescence or chemiluminescence...research setting, antibodies of different isotypes can be used together in the same experiment because the...this, it may contain many epitopes that antibodies can recognize. Imagine you’re doing a word search puzzle...But, there are actually many ways that antibodies can be produced for research purposes, some of which ...
  17. Transferable Skills Guide: Conflict Resolution

    Type
    Blog Post
    ... your technical skills, can open new career opportunities for you, if you can identify them in yourself... conflict can fall into “groupthink” and fail to evolve. Recognizing when “bad” conflict can be spun into...conflict can lead to people disagreeing with each other just for the sake of disagreeing. It can be extremely...creating new avenues of communication can create as many problems as it can solve. Many of us have heard the...common good. If you can get past that hurdle, there are a few more tools that can come in handy: Empathy...inherently bad, and in many cases it can be. If people or teams can’t see eye to eye on something and a .... There are countless classes and resources that can provide details and vocabulary for this skill. What...
  18. Revamp Your Lab Meetings With Creative Virtual Collaboration

    Type
    Blog Post
    ...participants can contribute and sketch on the board without leaving Zoom. The annotate function can also make... and take minutes that can be accessed by anyone at any time. This document can be shared and serve as... to group together. Breakout Rooms can be used as a break, but can also be used to brainstorm on data ...Cornell Medicine. Discussing data with colleagues can be more difficult during the pandemic era, with fewer...and/or be in the lab at odd times, new strategies can make socially distanced work more creative. An example...their thoughts. Then at the lab meeting, the team can discuss those ideas and build from those.   ... Figure 1: Virtual lab meeting? No problem! You can still creatively collaborate and brainstorm! Image...
  19. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type
    Blog Post
    ...optical microscope can be very difficult, so how do you know it’s there? For this task, you can use PCR based...luminescence. This can then be detected by a luminometer. Non-specific DNA stains can be added in the infected...antibiotic agents. These agents can be used to wash the cell cultures. The treatment can take a few weeks to a ...difficult to eradicate. You can suppress the growth of mycoplasma but cannot eradicate it completely. When...mycoplasma. These methods cannot guarantee complete removal of mycoplasma but, can get rid of most of mycoplasma...drugs like penicillin and streptomycin. Mycoplasma can pass through filtration methods because of its ability...source among those mentioned above. The contaminants can spread through dirty clothing, lab wears, human speech...
Showing: 121 - 140 of 1074 results