We narrowed to 1,084 results for: ANT
-
TypeCollection...Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used with a repair... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in...created by wild type Cas enzymes. To use a nickase mutant, you will need two gRNAs that target opposite strands...
-
CRISPR Pooled gRNA Libraries
TypeCollection...collection differ based on some important criteria, and it is important to know which library best... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...with the pooled library to create a population of mutant cells that are then screened for a phenotype of...representation. CRISPR screening experiments require large quantities of cells and therefore, may not be suitable for...best suits your particular experiment. Some important variables include: Type of genetic modification - ... -
Plasmids for Stem Cell Research
TypeCollection... to embryonic stem cell use and has the major advantage that iPSCs can potentially be derived from patient-specific...mutation and minimize tumorigenicity, an inherent disadvantage of iPS cell technology. Browse Addgene's collection...create cell lines with endogenously-tagged gene variants or browse Addgene’s entire collection of Stem ...and Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii...Mouse Direct reprogramming of fibroblasts into antigen-presenting dendritic cells. Sci Immunol. 2018 Dec...Lentiviral Mouse Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Cell... -
Tetracycline Inducible Expression
TypeCollection...hormones or metal ions, scientists have adapted an antibiotic resistance operon from E. coli : the tetracycline...elements like the H1 RNA promoter. And, most importantly, the TetR protein has been modified to provide...identify the amino acid residues of TetR that were important for tetracycline-dependent repression. Mutating...). rtTA3 and Tet-On 3G : further improved rtTA variants with lower background activity and greater sensitivity...#85972 for hygromycin selection. TetR H1-2O2 Cindy Miranti 104321 tet-pLKO-sgRNA-puro Lentiviral Tet-On plasmid...Lentiviral Tet-On inducible RNAi with miR-E (miR-30 variant)-based backbone rtTA-Advanced TRE3G Johannes Zuber... -
Lentivirus Plasmids
TypeCollection...both dividing and non-dividing cells without a significant immune response. These viruses also integrate...that encodes genetic material that the researcher wants delivered to specific target cells. This genome ... See article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion...destination plasmid for cDNA expression Ramalho-Santos 24129 pULTRA 3rd bi-cistronic expression of EGFP...fusion. See plasmids 36083 and 36086 for other FP variants. Tsoulfas 41393 pCW57.1 3rd Inducible lentiviral... -
Optogenetics AAV Preps
TypeCollection...other mutants Chronos, Chrimson, ChRmine, ChroME, ChETA, C1V1 (t/t) Inhibitory Arch and variants eNpHR...eNpHR and variants Jaws WiChR stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx...AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know... -
Validated gRNA Sequences
TypeCollection...gRNA activity. Know your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this...compatible with a single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S...elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG...elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C. elegans GCTACCATAGGCACCACGAG...CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S.... -
Depositor Collections
TypeCollection...Collections Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection Disease...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression... Simpson Reagents for improved expression of recombinant phosphoproteins - Rinehart FreeGenes Project ... -
CRISPR Plasmids - Epigenetics
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...technologies also indirectly modify local chromatin state. Want more information on the wide variety of Cas enzymes...plasmids for epigenetic modification in mammalian or plant systems. Mammalian ID Plasmid Gene/Insert Promoter...Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication... -
CRISPR Plasmids - Repress Gene Expression
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...target the dCas9-repressor to your specific locus. Want more information on the wide variety of Cas enzymes... for expression in mammalian systems, bacteria, plants, and yeast. Mammalian ID Plasmid Gene/Insert Promoter... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...target the dCas9-activator to your specific locus. Want more information on the wide variety of Cas enzymes...expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian ID Plasmid Gene/Insert Promoter... ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker... -
CRISPR Plasmids - RNA Targeting
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...the collateral RNA degradation seen in bacteria. Want more information on the wide variety of Cas enzymes... expression in mammalian systems, bacteria, and plants. Mammalian ID Plasmid Gene/Insert Promoter Selectable...Bacterial ID Plasmid Gene/Insert PI Publication Plant ID Plasmid Gene/Insert PI Publication Do you have... -
CRISPR Plasmids - Double-Strand Break (Cut)
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources...HDR occurs at a much lower efficiency than NHEJ. Want more information on the wide variety of Cas enzymes...expression in mammalian systems, bacteria, Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus. Mammalian...Insert Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker... -
CRISPR Plasmids - gRNAs
TypeCollection... gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources... increases off-target effect. Which species or variant of Cas9 ( S. pyogenes , S. aureus etc.) was this...compatible with a single species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be...information and assistance with the deposit process. Want more information on the wide variety of Cas enzymes... -
CRISPR Plasmids and Resources
TypeCollection...designed for use in parasites. Plant CRISPR plasmids designed for use in plants. Yeast CRISPR plasmids designed... for a variety of organisms, including mammals, plants, bacteria, yeast, Drosophila, zebrafish, C. elegans...tool for genome engineering. CRISPR Topic Page : Want the latest news on CRISPR? Experts cover CRISPR ... -
Adenovirus Plasmids
TypeCollection...mild to severe respiratory disease in humans. Advantages of adenoviruses in research include their large...adenoviruses do not integrate into the host genome. Disadvantages of adenoviruses include transient transgene ...transgene expression, as well as the substantial immune response induced by the viral capsid. Adenoviruses can...Plasmids Common shuttle and adenoviral plasmids. Want an adenoviral plasmid with your gene of interest... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...protein, and is suitable for both cell-permeant and non-cell-permeant proteins. CLIP-tag CLIP-tag is identical...proteins with disulfide bridges such as antibodies. MCP-tag is a mutant of ACP-tag, and is labeled by SFP Synthase... -
mTOR Pathway
TypeCollection...Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial cancers...uncontrolled cell growth and proliferation, including an abundant supply of macromolecules and energy, as well as... as the presence of both pro-proliferative and anti-apoptotic signals. mTORC2, which appears to signal... mTOR signaling in growth control and disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...originally discovered as contaminants of adenovirus stocks. One major advantage of using AAV for research...low immune response and low toxicity. Although recombinant AAV does not integrate into the host genome, ...AAV Viral integration AAV serotypes Pseudotyping Want to save time? Check out our Viral Vector Packaging... -
Lentiviral Prep Service
TypeCollection...single-stranded breaks ( nicks ). ID Name Insert Function Antibiotic Resistance Activity PI 52962 lentiCas9-Blast ... a transcriptional activator . ID Name Insert Antibiotic Resistance Activity PI 61422 dCAS9-VP64_GFP dCAS9... express fluorescent proteins. ID Name Insert Antibiotic Resistance Purpose PI 17446 pLenti CMV GFP Hygro... in a new window) . Please note this does not guarantee viral service, but lets us know what viruses would...