We narrowed to 172 results for: TOX
-
TypeBlog Post...for the sake of disagreeing. It can be extremely toxic in a lab or work environment if left unchecked. ...
-
Five Popular Model Organisms
TypeBlog Post...Yeast models of PD, like those that overexpress the toxic protein α-synuclein (the most common protein found... -
The Fluorescent Vegetables in Aptamer Soup
TypeBlog Post...imidazolinone (DFHBI). DFHBI is membrane permeable and non toxic to cells. Because it rapidly photobleaches, DFHBI... -
Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus
TypeBlog Post...non-functional, they could be dominant-negative and/or toxic. A potential solution is to include an in-frame ... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...reduced growth rates, especially if that transgene is toxic. Eventually, the rapidly growing low-level transgene... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...reproducibility in science. Safety Warnings Sodium azide is toxic. When handling, use proper personal protective equipment... -
Plan Your Experiment
TypeCollection... lowest immunogenicity and are one of the least toxic methods for in vivo viral delivery. Additionally... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...B4GALT1(1-61) mTurquoise2 Dorus Gadella 68073 GalToxBFP Golgi apparatus GalT signal anchor transmembrane... -
Is this the right place for me? 8 tactics for choosing a lab
TypeBlog Post... choose wisely. From the Tenure She Wrote blog, Toxic Academic Mentors. What is workplace bullying? ... -
Important Considerations When Using AAVs
TypeBlog Post...tracing methods used viruses that were potentially toxic and would result in cell death. With several new... -
Quick Guide to All Things Lentivirus
TypeBlog Post...constitutively or inducibly. If your gene of interest is toxic or needs to be expressed a certain point in the ... -
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency
TypeBlog Post...repair templates. They found that Cas9 RNPs could be toxic at high concentrations, and editing efficiency improved... -
RNA Interference in Plant Biology: New Tools for an Old Favorite
TypeBlog Post...organisms with functional APT will convert 2-FA to cytotoxic nucleotides, resulting in death. In the presence... -
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...removal from the infected culture. MRAs are non-toxic, effective in the removal of most of the mycoplasma... -
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering
TypeBlog Post... of Red proteins is critical for minimizing the toxic effects of Gam expression and to limit spontaneous... -
Sequencing Options for CRISPR Genotyping
TypeBlog Post...multiplexing Requires delivery of dsODN (potentially toxic) Digenome Seq 0.1% Cell-free (in vitro) Works ... -
AAV Production in HEK293 Cells
TypeProtocol...post transfection. Changing the media can reduce toxicity associated with PEI and allow for the addition... -
Custom CRISPR Screens & the Green Listed Software
TypeBlog Post...phenotype (e.g. survival of a cancer cell as a cytotoxic drug is added), and decide which genes you’d like... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...was originally developed to treat heavy metal intoxication in chemical warfare [Vilensky & Redman, 2003... -
Validated gRNA Sequences
TypeCollection...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...