Addgene

We narrowed to 169 results for: TOX

Showing: 141 - 160 of 169 results

Results per page:

Transferable Skills Guide: Conflict Resolution

Type

Blog Post

...for the sake of disagreeing. It can be extremely toxic in a lab or work environment if left unchecked. ...
Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

Type

Blog Post

...Cas9 is no longer necessary. However, Cas9 can be toxic if continuously expressed (Fu et al., 2013). Using...
Hot Plasmids: Summer 2024

Type

Blog Post

...methyltransferase for epigenetic silencing, which can be toxic, CHARM uses a cofactor fused to a histone tail to...
CRISPR 101: Homology Directed Repair

Type

Blog Post

... can be used, however, these are generally more toxic to cells than their plasmid counterparts. Another...
Antibodies 101: Introduction to Gating in Flow Cytometry

Type

Blog Post

...-mouse CD8b-PerCP-Cy5.5), which is present on cytotoxic T killer cells but not dendritic cells. Using ...
Virus Protocol - Generating Stable Cell Lines

Type

Protocol

...reduced growth rates, especially if that transgene is toxic. Eventually, the rapidly growing low-level transgene...
Affinity Purification of Recombinant Antibodies with Protein A or Protein G

Type

Protocol

...reproducibility in science. Safety Warnings Sodium azide is toxic. When handling, use proper personal protective equipment...
Is this the right place for me? 8 tactics for choosing a lab

Type

Blog Post

... choose wisely. From the Tenure She Wrote blog, Toxic Academic Mentors. What is workplace bullying? ...
Important Considerations When Using AAVs

Type

Blog Post

...tracing methods used viruses that were potentially toxic and would result in cell death. With several new...
Quick Guide to All Things Lentivirus

Type

Blog Post

...constitutively or inducibly. If your gene of interest is toxic or needs to be expressed a certain point in the ...
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

Type

Blog Post

... of Red proteins is critical for minimizing the toxic effects of Gam expression and to limit spontaneous...
RNA Interference in Plant Biology: New Tools for an Old Favorite

Type

Blog Post

...organisms with functional APT will convert 2-FA to cytotoxic nucleotides, resulting in death. In the presence...
Mycoplasma Contamination: Where Does It Come From and How to Prevent It

Type

Blog Post

...removal from the infected culture. MRAs are non-toxic, effective in the removal of most of the mycoplasma...
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

Type

Blog Post

...repair templates. They found that Cas9 RNPs could be toxic at high concentrations, and editing efficiency improved...
Sequencing Options for CRISPR Genotyping

Type

Blog Post

...multiplexing Requires delivery of dsODN (potentially toxic) Digenome Seq 0.1% Cell-free (in vitro) Works ...
Validated gRNA Sequences

Type

Collection

...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...
AAV Production in HEK293 Cells

Type

Protocol

...post transfection. Changing the media can reduce toxicity associated with PEI and allow for the addition...
Custom CRISPR Screens & the Green Listed Software

Type

Blog Post

...phenotype (e.g. survival of a cancer cell as a cytotoxic drug is added), and decide which genes you’d like...
Special Delivery: Fluorophore Targeting for FRET Studies

Type

Blog Post

...was originally developed to treat heavy metal intoxication in chemical warfare [Vilensky & Redman, 2003...
Antibody Validation for Flow Cytometry

Type

Blog Post

...target with very low expression, due to induced toxicity caused by the protein of interest. HLDA workshop...

Showing: 141 - 160 of 169 results

Results per page:

Transferable Skills Guide: Conflict Resolution

Viral Vectors 101: Integrase-Deficient Lentiviral Vectors

Hot Plasmids: Summer 2024

CRISPR 101: Homology Directed Repair

Antibodies 101: Introduction to Gating in Flow Cytometry

Virus Protocol - Generating Stable Cell Lines

Affinity Purification of Recombinant Antibodies with Protein A or Protein G

Is this the right place for me? 8 tactics for choosing a lab

Important Considerations When Using AAVs

Quick Guide to All Things Lentivirus

Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

RNA Interference in Plant Biology: New Tools for an Old Favorite

Mycoplasma Contamination: Where Does It Come From and How to Prevent It

An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

Sequencing Options for CRISPR Genotyping

Validated gRNA Sequences

AAV Production in HEK293 Cells

Custom CRISPR Screens & the Green Listed Software

Special Delivery: Fluorophore Targeting for FRET Studies

Antibody Validation for Flow Cytometry

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections