Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 260 results for: gfp

Showing: 141 - 160 of 260 results

  2. Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System

    Type
    Blog Post
    ...fluorescent protein topics page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...unstable, it will be degraded, leading to reduced eGFP fluorescence. Cells expressing the library are then...fluorescence-activated cell sorting into four bins based on their eGFP:mCherry ratios. Genomic DNA from each bin are then extracted...

  6. Plasmids 101: Mammalian Vectors

    Type
    Blog Post
    ...be another method to assess transfection success. GFP is often used as a reporter and we will be covering...

  7. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid...

  10. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...

  11. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...

  12. AAV Molecular Tools

    Type
    Collection
    ...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Thomas Jessell , Eiman Azim... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...synaptophysin-EGFP for labeling of axon terminals. 1 Hongkui Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

  14. Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards

    Type
    Blog Post
    ...line, Hep3B. From left to right: Mitotracker Red, GFP for the biosensor, Hoechst, and overlay).   ...(DKFZ) who has developed new redox sensitive GFP2 (roGFP2)-based biosensors for live cells. His work focuses..., Pedre Pérez’s biosensor fuses MPST to roGFP2. Because roGFP2 contains two cysteines near the chromophore...the MPST hydrosulfide can be transferred to the roGFP2 cysteine thiols and change its fluorescence properties...

  16. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    ... for a researcher to come into contact with than GFP. Similarly, if the viral vector carries an shRNA ...

  17. Lentiviral Prep Service

    Type
    Collection
    ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ...

  20. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...
Showing: 141 - 160 of 260 results