...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not contain GFP Additional Vocabulary...throughout virus production. During experiments, GFP can be used to sort cells infected with adenovirus...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

...another marker, such as GFP. A researcher can use FACS to sort cells expressing GFP and later expand these...

...inactive dCas9 fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive...

...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk...

...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic...