We narrowed to 8 results for: gfp
-
TypeGuide...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...
-
Adenovirus Guide
TypeGuide...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...throughout viral vector production. During experiments, GFP can be used to sort cells infected with rAdV vectors...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors (or...adenoviral vector production that do not contain GFP. Recombinant adenoviral vector (rAdV) Modified form... -
Gamma-Retroviral Vector Guide
TypeGuide...selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead of ... sorting (FACS) is used to sort cells expressing GFP and later, sorted cells are expanded into a cell ... -
Lentiviral Vector Guide
TypeGuide...selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead of ... sorting (FACS) is used to sort cells expressing GFP and later expanded into a cell line. More information... -
Modular Cloning Guide
TypeGuide...a combinatorial library of constructs expressing GFP at 18 levels for rapid characterization in new organisms... -
Optogenetics Guide
TypeGuide...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk... -
Molecular Biology Reference
TypeGuide...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic... -
CRISPR Guide
TypeGuide...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...