Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 878 results for: cel

Showing: 871 - 878 of 878 results

  1. Finding Your Science Policy Path

    Type
    Blog Post
    ...example proposals and consider applying for their accelerator for some hands-on guidance.   Check out my webinar...

  4. Promoters

    Type
    Guide
    ...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...

  5. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...

  6. Modular Cloning Guide

    Type
    Guide
    ...assembly of cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can...MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete... create multigene constructs expressed in the cellulose-producing Komagataeibacter species. Ralstonia-...

  7. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...
Showing: 871 - 878 of 878 results