Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 386 results for: Lor;

Showing: 161 - 180 of 386 results

  2. Validated gRNA Sequences

    Type
    Collection
    ...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...

  4. OCaMP: A New Calcium Indicator for Neural Imaging

    Type
    Blog Post
    ... work, each indicator needs to emit a different color of light and be compatible with the lasers available...paired with green, yellow, and/or red sensors in multicolor experiments. With OCaMP, researchers can image...

  5. Fluorescent Proteins 101: Luciferases

    Type
    Blog Post
    ... of fluorescent proteins that produce different colors or have other advantageous properties. This approach... fluorescent protein emits light of a different color instead. This approach has even been used in biosensors...

  6. Antibodies 101: ChIP

    Type
    Blog Post
    ... ChIP is an incredibly useful application for exploring these interactions, and can give valuable insight... with a PCR purification kit or with a phenol-chloroform extraction.    Fig. 1: Schematic overview...

  8. A Quick Guide to a Career in Software Product Management

    Type
    Blog Post
    ...others, and have strong communication skills to tailor your message to any type of audience. Additionally...more and more people will have the opportunity to explore a career in product management.  A day in the life...

  9. Plasmids 101: The protein expression toolbox

    Type
    Blog Post
    ...tried-and-true protein expression control tools as well as explore some new innovations. Whether you want to turn ...introduced gene or over the native locus? Let’s explore each of the options together. Turn it off Turn...

  10. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    ...Chicken IgY domains are especially useful for multi-color staining of tissue because they have limited cross-reactivity...cultured cells and tissue sections Great for multicolor staining of tissue since it won’t cross-react...

  13. Working with Nuclear Receptors

    Type
    Blog Post
    ...reporter gene has over the years evolved from chloramphenicol acetyltransferase to luciferase, the basic ... Professor of Molecular and Cellular Biology at Baylor College of Medicine and Editor-In-Chief of the ...

  14. CRISPR in the Clinic

    Type
    Blog Post
    ...example, in 2013, Jinsong Li and colleagues chose to explore CRISPR’s therapeutic potential in mice with a dominant...component, CAR. Clinical trials are underway to explore CRISPR’s capacity for both classes of edits in ...

  15. Adenoviral Vector Production and Troubleshooting

    Type
    Blog Post
    ...standard method for purification of rAdV uses cesium chloride (CsCl) density gradients combined with ultracentrifugation...practical guide for using the AdEasy System. 3. Jager, Lorenz, et al. "A rapid protocol for construction and ...

  16. Hot Plasmids - October 2020

    Type
    Blog Post
    ...synapses or that are Cre-inducible, researchers can explore synaptic integration and connectivity without the...Guo and her colleagues at Yale University fused a color-changing fluorescent timer (FT) protein to the histone...

  17. Of Myc and Men

    Type
    Blog Post
    ...ll dive into those questions in this post as we explore… the life and times of the myc tag.  Origins of...that their new monoclonals would help the field explore Myc’s role in cell proliferation and tumorigenesis...

  18. Hot Plasmids: Summer 2025

    Type
    Blog Post
    ...super-resolution microscopy. To make this segment of the color spectrum more powerful, the lab of Francois St-Pierre...EGFP, or mScarlet reporters, so you can choose a color compatible with the other tools in your experiment...

  19. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...quickly. Of course, you might have less time to explore scientifically since you can’t afford to spend ...time working on something extremely risky or exploratory. Getting a job afterwards: Fairly or unfairly...
Showing: 161 - 180 of 386 results