We narrowed to 8 results for: Lor;
-
TypeGuide...Channelrhodospin plasmids . Halorhodopsins Halorhodopsins are light-gated inward chloride pumps isolated from ...species include: CsChR (from Chloromonas subdivisa ), CoChR (from Chloromonas oogama ), and SdChR (from ...Jaws Browse Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense...Channelrhodopsin from Chloromonas oogama CsChR Channelrhodopsin from Chloromonas subdivisa CheRiff Channelrhodopsin... mutations 540 Channelrhodopsins: chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations... ReaChR variant 517 Halorhodopsins Jaws Red-shifted, light-driven inward chloride pump from Haloarcula...identified in other species - by acting as light-gated chloride channels, these variants result in the hyperpolarization...
-
Antibody Guide
TypeGuide... Here, HRP is used as a colorimetric, in which the reaction produces a colored product that accumulates...well. In colorimetric assays, protein amount can be determined by correlating the amount of color in a well...small multiplex experiments 4-color flow panel: BV421, FITC, PE, and APC 4-color microscopy panel: DAPI for...molecules , proteins that emit a measurable light or color in response to a specific stimulus, can be conjugated...than HRP, fluorophores are available in a range of colors activated by different wavelengths, allowing for...indirect or direct method. Since IF uses fluorophore color to differentiate between the targets of interest...theoretically allow for roughly fifty different fluorophore colors in flow cytometry, but the largest panels used ... -
Chemogenetics Guide
TypeGuide... Compound 21, Deschloroclozapine (DCZ), Perlapine, and Olanzapine have all been explored as alternative...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...a new window) Strader CD, Gaffney T, Sugg EE, Candelore MR, Keys R, et al. (1991). Allele-specific activation... -
CRISPR Guide
TypeGuide...fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging can be achieved by using orthogonal... L., Jung, K., McCool, R. S., Johnson, K. A., & Taylor, D. W. (2022). Structural basis for mismatch surveillance...Petris, G., Montagna, C., Reginato, G., Maule, G., Lorenzin, F., Prandi, D., Romanel, A., Demichelis, F., ...Zhang, H., Finkelstein, I. J., Johnson, K. A., & Taylor, D. W. (2024). Unraveling the mechanisms of PAMless...Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor CRISPR labeling of chromosomal loci in human ...., Ramos, D., Hibshman, G. N., Wright, J. T., & Taylor, D. W. (2023). Structural snapshots of R-loop formation... -
Molecular Biology Reference
TypeGuide...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Hygromycin...as a sequencing chromatogram which provides the color and intensity of each fluorescent signal. Sanger...bases and a microscope captures the fluorescent color that is emitted each time a base is added. Again...base (A,C,T, or G) is labelled with a different color making it easy to identify the order of the DNA ... -
Sequencing Primers
TypeGuide...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward... -
Adenovirus Guide
TypeGuide... (Link opens in a new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral... -
Adeno-associated virus (AAV) Guide
TypeGuide...short coding sequences of channelrhodopsins, halorhodopsins, and other optogenetic genes makes them suitable...