Skip to main content

We narrowed to 403 results for: aga

Showing: 161 - 180 of 403 results
  1. How to Design Your gRNA for CRISPR Genome Editing

    Type
    Blog Post
    ...signal in these assays (Dempster et al., 2019). Again, the experimental strategy is clear: for any gene...0059-1 Veres A, Gosis BS, Ding Q, Collins R, Ragavendran A, Brand H, Erdin S, Cowan CA, Talkowski ME, ...
  2. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ... create a thin sheet of excitation light that propagates perpendicular to an imaging objective that collects...excitation light is completely reflected, energy is propagated into the sample via an evanescent wave that only...
  3. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...receptor are stained with a fluorescent antibody against the receptor and analyzed on a flow cytometer. ...methods. In direct staining, the primary antibody against a target is conjugated to a fluorochrome. In indirect...
  4. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...animal, and its B cells will churn out antibodies against the injected protein. Several weeks later, blood...protein. However, each animal will make antibodies against different protein epitopes and so variability between...
  5. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...steps and the joined modules cannot be separated again by the same cloning enzymes. MXS (MluI-XhoI-SalI...properties, they generated monoclonal antibodies against them, fused them to GFP, and compared them to popularly...In order to overcome these limitations, Takeharu Nagai and colleagues at Osaka University have developed...
  6. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...affordably in bacteria. They are compatible with both agarose and polyacrylamide gels. They are shared through...utilize CRISPR Cas9 systems to defend themselves against bacteriophage infection, but some phages fight ...
  7. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...increase the chances of inducing an immune response against the capsids or transgenes. Sensory neurons and ... is not neutralized by pre-existing antibodies against AAV9-based vectors (and vice versa), enabling repeat...
  8. 'Tis the Season to #DeckTheLab

    Type
    Blog Post
    ...creative scientists will deliver some fabulous photos again this year! Why #DecktheLab? Help us spread some...
  9. Sequencing Primers

    Type
    Guide
    ...pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice...Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse ...with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse ...CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...
  10. We’re Going Viral This Week!

    Type
    Blog Post
    ... the viral service, and now we’re “going viral” again! #AddgeneGoesViral on Twitter Starting today, our...
  11. Editor's Choice, October 2016

    Type
    Blog Post
    ...was no less busy for the Addgene blog which once again had record readership with over 75,000 views. Changing...
Showing: 161 - 180 of 403 results