We narrowed to 6 results for: aga
-
TypeGuide...GCC, GCA, GCG Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG Asparagine Asn N AAU, AAC Aspartic acid Asp ...allow for the propagation of the plasmid within bacteria, while allowing for selection against any bacteria...bacteria with plasmids, thus selecting against the propagation of these plasmids through cell division...Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics commonly used for plasmid...technology, which enables the preparation of more managable (i.e., smaller) DNA fragments. In 1952, Joshua...more. Regardless of type, plasmids are generally propagated, selected for, and the integrity verified prior...to use in an experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod shaped...
-
Sequencing Primers
TypeGuide...SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 ...AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...AUG1 promoter, reverse primer BGH Reverse TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator...beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse...immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer... promoter, forward primer EF-1a Forward TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a ... -
Antibody Guide
TypeGuide...which is immobilized on agarose or magnetic beads. Using centrifugation (for agarose beads) or a magnet (...developed, the antibodies are collected, tested against the antigen, packaged, and sold. This is the most...unknown Monomer with a valency of 2 IgE Protects against parasites and is responsible for driving allergic... directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs...materials. There are two primary methods used, using agarose or magnetic beads, but both rely on the same general...most or all of their extracellular matrix removed. Again, the signaling molecule may be a fluorophore or ...or more conjugated primary antibodies, and wash again. Use controls to identify, or gate, cells by size... -
Adenovirus Guide
TypeGuide... used viral vector platform for vaccine design against a diversity of viruses. This guide contains many...this, and to the strong host’s immune response against the transduced cells, transgene expression delivered...mammalian hosts and have been used as vaccines against infectious diseases such as COVID-19, Ebola virus... immunity to Ad5 and protect nonhuman primates against ebolavirus challenge . Journal of Virology, 85 ...) PMID: 17546019 (Link opens in a new window) Matsunaga, W., & Gotoh, A. (2023). Adenovirus as a vector... -
CRISPR Guide
TypeGuide...systems that bacteria and archaea use to protect against these foreign nucleic acids. Acr family members...3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s..., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., ...: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome ... -
Chemogenetics Guide
TypeGuide...olanzapine has also been shown to be an agonist against hM4Di, and is especially attractive for use in ...eaav5282. PMID: 30872534 (Link opens in a new window) Nagai Y, Miyakawa N, Takuwa H, Hori Y, Oyama K, Ji B, ...