Skip to main content

We narrowed to 335 results for: aga

Showing: 1 - 20 of 335 results
  1. Cloning Mammalian Cells with the Agarose Method

    Type
    Blog Post
    Published
    Sept. 7, 2017, 12:17 p.m.
    ...using the agarose cloning method Test your agarose temperature. Cloning cells using an agarose overlay ...to pour the agarose onto the recipient plate at just the right temperature. If the agarose solution is...the plate. We test the (capped) 1:1 agarose/DMEM solution against a part of the body very sensitive to...gene of interest. Advantages of the agarose cloning method The agarose technique should be useful to scientists...containing a low percentage of agarose, which is then overlaid with the firmer 2% agarose gel solution discussed...aerated with a thin layer of molecular biology-grade agarose containing physiological concentrations of salts...visible to the naked eye) with a marker prior to agarose addition, we found it was possible to rapidly punch...
  2. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

    Type
    Blog Post
    Published
    June 18, 2020, 1:15 p.m.
    ...for generating sybodies against membrane proteins Developing antibodies against proteins embedded in membranes... challenging when trying to develop antibodies against unstable targets like membrane proteins that may...plasmids to generate sybodies, synthetic nanobodies against the spike protein (Walter et al., 2020). No llamas...selection of synthetic nanobodies, called sybodies, against membrane protein targets in as little as 3 weeks...Outline of the process for selection of sybodies against membrane proteins. Image from Zimmermann et al....Seeger MA (2020) Generation of synthetic nanobodies against delicate proteins. Nature Protocols 15:1707–1741...
  3. Antibodies 101: Immunoprecipitation

    Type
    Blog Post
    Published
    Dec. 7, 2021, 2:15 p.m.
    ...method, an antibody against a target protein is immobilized, or tethered, on agarose or magnetic beads ...antibody, often called the capture antibody, to agarose or magnetic beads in a way that also allows the... the recombinant Protein A/G are conjugated to agarose or magnetic beads and allowed to bind to the antibody... The beads can be collected by centrifugation (agarose beads) or a magnet (magnetic beads), providing ...these, antibodies can be directly conjugated to agarose or magnetic beads with commercially available chemical... beads, there are several factors to consider. Agarose beads are sponge-like and vary in shape and structure...solid spheres and tend to be much smaller than agarose beads. Proteins conjugate on the surface of magnetic...
  4. Deep Dive: qPCR

    Type
    Blog Post
    Published
    Sept. 29, 2022, 1:15 p.m.
    ... Yes Agarose gel or uMelt analysis Hairpin probes Low Yes, one Yes Yes Agarose gels ...another means, such as an agarose gel or uMelt analysis (Downey, 2014). Agarose gels  A quick way to validate...double-quencher design Yes, one Yes Yes Agarose gel or uMelt analysis dsDNA dye (Sybr)  High...structure included in the 5’ primer Yes Yes. Agarose gel  LUX fluorogenic primers Low Single...fluorescent molecule connected to a primer  No Yes Agarose gel Sunrise primers   Low Reporter and ...hairpin structure included in primer Yes Yes Agarose gel Table 1: Features of various qPCR chemistries...primer probe is by running your qPCR product on an agarose gel, then cutting out and sequencing the band for...
  5. Lab Automation at Addgene

    Type
    Blog Post
    Published
    March 22, 2018, 1:28 p.m.
    ...amount of agar. There is a tube that goes from the needle to the flask with agar in it. The agar sits on...magnet so that the agar doesn’t solidify while it goes through this process. With enough agar and the right...transformation, DNA purification, and filling vials with agar. I’ll also provide you with some tips on how to ...re transferring samples from 96 wells plates onto agar q-trays where the samples must be spread much farther... The majority of Addgene plasmids are shipped as agar stabs in glass vials. Have you ever wondered who...
  6. DNA Purification Without a Kit

    Type
    Blog Post
    Published
    Feb. 11, 2020, 2:15 p.m.
    ...purifying (plasmid, genomic, or DNA fragments from agarose).    In this article, we will go through the basics...filters Starting material: bacterial cultures or agarose gel slices Product: plasmids or DNA fragments The... extraction with glass milk Starting material: agarose gel slices Product: DNA fragments You might be ...“How is milk going to help me extract DNA from agarose gel?!”   The DNA gel extraction with glass milk... this protocol: 1) it solubilizes both DNA and agarose, and 2) it helps DNA stick to the glass. After ...procedure. Additionally, purified DNA was free of agarose and could be digested with restriction enzymes....purification Starting material: PCR product or agarose gel slices Product: purified PCR product or DNA...
  7. Plasmids 101: CcdB - The Toxic Key to Efficient Cloning

    Type
    Blog Post
    Published
    Dec. 8, 2016, 3:30 p.m.
    ...stated, ccdB makes cloning easier by selecting against vectors that did not take up your insert. But exactly...antitoxin protein (CcdA) that protects the cell against the toxic CcdB. Cells that lose ccdA through the...expressed the ccdB gene and were therefore unable to propagate because CcdA wasn’t available to counteract the...allowing cells expressing the recombinant plasmid to propagate. Any cells that contained non-recombinant vectors...advantage of the same principle that cells will not propagate while expressing the gene. Briefly, the vector...DB3.1 or ccdB SurvivalTM, one can efficiently propagate and prep plasmids containing the ccdB gene, which...are F’. These strains could possibly be used to propagate and prep your ccdB-containing empty backbones ...
  8. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    Published
    Jan. 10, 2023, 2:15 p.m.
    ... uncut DNA control: a band or two appear on an agarose gel at notably higher molecular weights than expected...Plasmid Multimers Run an undigested plasmid on agarose gel Running undigested DNA on a gel as a control...same fragment sizes and banding patterns on an agarose gel as the monomeric version. However, undigested...than monomers and will therefore run higher on an agarose gel (Bedbrook & Ausubel, 1976). In fact, if your... how different plasmid conformations run on an agarose gel). If the presence of a multimer in your sample...digestion and then run the linearized plasmid on an agarose gel. You can then gel extract the linearized band...Analysis of DNA topoisomers, knots, and catenanes by agarose gel electrophoresis. Methods Mol Biol. 2009;582...
  9. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type
    Blog Post
    Published
    Oct. 8, 2020, 1:15 p.m.
    ... culture. Reusing the same bottle of serum again and again for each subculture can enhance the growth ...liquid broth and on the agar plates. Mycoplasma colonies are easily visible on the agar plates. This method...based detection, DNA staining, fluorescent tagging, agar plating, etc. Be wise to choose any of the techniques...sampling (Uphoff and Drexler, 2011). Culturing on agar plates/broth is considered the ‘gold standard’ for...Cyclin, fluoroquinolone ciprofloxacin, ciprobay, zagam, baytril, tetracycline, etc. are available for mycoplasma...
  10. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    Published
    March 13, 2014, 4:08 p.m.
    ....2842  Soldner, F., Laganière, J., Cheng, A. W., Hockemeyer, D., Gao, Q., Alagappan, R., Khurana, V., Golbe...itself, will protect the HR template from the Cas9. Again, if it's within coding region make sure it's a silent...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ....08.021  Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome ...
  11. The Stingy Scientist: How the Baby Gel Box Was Born

    Type
    Blog Post
    Published
    April 15, 2014, 3:11 p.m.
    ...so the agarose doesn’t pour over the sides.  These tiny gels and tiny lanes required less agar, less ethidium...own glass milk for purifying cut plasmid DNA from agar slices.  Molecular biologists used this procedure...project started when I realized I was pouring large agarose gels for DNA visualization or isolation, then using...using glass slides. With just the right amount of agarose, I could pour a very thin gel on a large glass ...
  12. CRISPR Antimicrobials

    Type
    Blog Post
    Published
    May 3, 2016, 2:30 p.m.
    ...antimicrobials could become our newest line of defense against bacteria. Created with BioRender.com. ...resistant bacteria, allowing them to multiply and propagate their resistance genes. Our society is hoping ... just the method needed to jumpstart the fight against antibiotic resistance. Advantages of CRISPR over...targeted two distinct beta-lactam resistance genes, again with very high specificity. This double phage system...strategy can help us win back ground in the fight against bacterial superbugs. References 1. Citorik, Robert...
  13. Plasmids 101: Choosing an Antibiotic Resistance Gene

    Type
    Blog Post
    Published
    Oct. 10, 2023, 1 p.m.
    ...express a gene contained in a plasmid. During the propagation and/or transformation process, some bacteria ...known to produce satellite colonies when used on agar plates due to the fact that beta-lactamase is excreted...transformations. Cons: Prone to satellite colony formation on agar plates, less stable at high temperatures and in ...environments and is less susceptible to degradation in agar plates. This prevents satellite colonies from forming...Addgene’s Basic Molecular Biology Protocols Over-Agar Antibiotic Plating Plasmids 101 eBook Resources...
  14. The Developmental Studies Hybridoma Bank: Over 25 Years of Antibody Sharing

    Type
    Blog Post
    Published
    March 10, 2015, 2:25 p.m.
    ...hybridoma lines, each producing a monoclonal antibody against a target antigen. This contrasts with polyclonal...popular monoclonal antibodies include those directed against human transcription factors such as PAX7, PAX6,... addition, we distribute monoclonal antibodies against popular fluorescent proteins (GFP and YFP) and ... high profile antigens; and 4) generating mAbs against new cancer biomarkers. We believe that repositories...
  15. 2018 #DeckTheLab Contest Winners

    Type
    Blog Post
    Published
    Jan. 15, 2019, 2:19 p.m.
    ...neurons on the lab door, and lot of agar art. This collection of agar art from Nika Heijmans stood out to...out of the bunch and here’s what ended up on top. Agar art from Nika Heijmans There were many science-themed... to the Addgenies. Happy holidays!🎄☃️ More #agarart from our lab @SILS_UvA 🧬🧫 Soon on display @Micropia...
  16. Strengthening Foundations: Reflections on 2025 and What's Ahead for 2026

    Type
    Blog Post
    Published
    Feb. 5, 2026, 4:15 p.m.
    ...Alvarez, M. F., & Chavarriaga, P. (2025). Revealing the role of the AGO4 gene against rice hoja blanca ...Addgene-shared tools to develop new vaccine approaches against emerging viral threats, or scientists in Colombia... of self-amplifying and circular mRNA vaccines against SARS-CoV-2. iScience, 28(10), 113498. https://doi.org...
  17. The Strength of Story Telling

    Type
    Blog Post
    Published
    Dec. 19, 2017, 2 p.m.
    ...is to keep working on telling a story again and again and again until you work out what people enjoy and...Jack Leeming Editor of Naturejobs, part of Nature magazine. Humans are built to enjoy, remember, and listen...
  18. RANbodies: Reporter Nanobody Fusions

    Type
    Blog Post
    Published
    April 10, 2018, 12:56 p.m.
    ...RANbody plasmids from Yamagata et al can be found here. Can’t find a RANbody against your favorite protein...single domain antibody. To create their RANbodies, Yamagata et al used previously published nanobody sequences...the comments below. References Sanes, J.R., & Yamagata, M. (2018). Reporter-nanobody fusions (RANbodies...
Showing: 1 - 20 of 335 results