Skip to main content
Addgene

We narrowed to 58 results for: gag pol

Showing: 1 - 20 of 58 results
  1. Viral Vectors 101: Gamma-Retroviral Packaging Systems

    Type
    Blog Post
    Published
    Aug. 6, 2024, 1:15 p.m.
    ...Packaging genes (viral Gag-Pol): Gag is a structural precursor protein, and Pol is a polymerase. Envelope gene...γ-retroviruses use the same gene products for packaging (Gag, Pol, and Env), the isoforms of these proteins, as ...utilizes a packaging cell line that stably expresses Gag-Pol and/or Env, eliminating the need to deliver these...Garry Nolan at Stanford (Swift, 2001) contains Gag-Pol and either an ecotropic envelope, Phoenix-ECO, ...days. Another variant, Phoenix-gp, contains only Gag-Pol and enables additional flexibility in pseudotyping...lentiviruses and standard γ-retroviruses use the Gag, Pol, and Env genes for packaging; however, they are...Pseudotyped to alter infectivity. Packaging Gag Precursor structural protein of the retroviral ...
  2. Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells

    Type
    Blog Post
    Published
    Sept. 26, 2019, 12:50 p.m.
    ...MLV Gag protein. After Gag-Cas9 is incorporated, the MLV protease, supplied as part of the MLV Gag-Pol...Image from Mangeot et al., 2019.   MLV GAG-POL polyprotein Nanoblades are formed when viral structural...can be purified by centrifugation. Gag-Cas9 fusion protein The MLV Gag protein fused to a Flag-tagged SpCas9...structural proteins, such as the MLV protein Gag, multimerize and spontaneously assemble into particles at the...dCas9-VPR, if these variants are fused to the MLV Gag in place of SpCas9. gRNA A gRNA targeting a DNA sequence... by association with the the Cas9 portion of the Gag-Cas9 fusion protein. A single Nanoblade particle ...incubating Nanoblade particles with polybrene, a cationic polymer. Polybrene has long been used to increase...
  3. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    Published
    April 23, 2014, 1:08 p.m.
    ...gamma-retroviruses use the same genes for packaging (that's gag, pol, and env), the isoforms of these proteins, as ... and a packaging plasmid encoding HIV proteins gag, pol, rev, and tat. 3rd generation systems require ...plasmid, and two packaging plasmids, one encoding gag and pol and a second encoding rev.  Secondly, 3rd generation...production (3 or 4). Third-generation vectors contain gag, pol, and rev. Second-generation contains those three...
  4. Viral Vectors 101: Viral Vector Elements

    Type
    Blog Post
    Published
    July 25, 2023, 1 p.m.
    ...wondered what goes into ‘making virus’ or what gag and pol stand for, we demystify all components of viral...particle to interact with the host. This is the role of Gag proteins: they contain the matrix, capsid, and nucleocapsid...needed for viral packaging, assembly, and display. Pol, the last component, contains the reverse transcriptase...The 5’ LTR and 3’ LTR, respectively, act as RNA polymerase II promoter and terminator regions and are slightly...replication, with E2B being the primary viral polymerase. E4/E1A activate transcription of other relevant...
  5. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    Published
    Jan. 8, 2019, 1:54 p.m.
    ...from the Didier Trono lab that expresses the HIV gag, pol, rev, and tet genes. It can be used with 2nd or...plasmid from the Trono lab that contains the gag and pol genes. It also requires pRSV-Rev and the envelope...
  6. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    Published
    June 22, 2023, 1:15 p.m.
    ...plasmid (envelope plasmid), and the polymerase (Pol) for replication and Gag structural protein on yet a third...cell line with those particles. Since the Env, Gag, and Pol genes are not encoded in the transfer plasmid... be disposed of following your lab’s biohazard policies. Administering Virus Many virus experiments involve... accident-prone researchers. Note that safety policies will vary slightly from organization to organization...with your specific organization/department/lab’s policies – basically, you’ll need to get trained in each...
  7. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    Published
    May 19, 2016, 2:30 p.m.
    ...important for viral production: Gag (structural precursor protein), Pol (polymerase), Tat (viral transactivator... plasmids: one encoding Rev and one encoding Gag and Pol, increasing the number of recombination events...Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, Trono D. Science. 1996 Apr 12;272(... L, Bernaudin F, Girot R, Dorazio R, Mulder GJ, Polack A, Bank A, Soulier J, Larghero J, Kabbara N, Dalle...lentivirus vector. Miyoshi H, Blömer U, Takahashi M, Gage FH, Verma IM. J Virol. 1998 Oct;72(10):8150-7. PubMed...
  8. Plasmids 101: Terminators and PolyA signals

    Type
    Blog Post
    Published
    March 31, 2016, 2:30 p.m.
    ...constitutive RNA transport element lead to enhanced HIV-1 Gag expression in a context-dependent manner. Nucleic... both polyadenylation and termination. Out of those listed, the SV40 late polyA and rbGlob polyA are thought...any 3’ regulatory elements, such as the polyadenylation or poly(A) signal. While many studies focus on ...purpose and mechanism of polyadenylation vary across cell types, but polyadenylation generally serves to promote...consensus sequence for the addition of a poly(A) tail, the addition of a poly(A) tail on a prokaryotic transcript... termination and polyadenylation Unlike prokaryotes that have a single RNA polymerase for transcription...transcription, eukaryotes have three RNA polymerases (Polymerases I, II, and III), each responsible for transcribing...
  9. Engaging with science and society at pgEd

    Type
    Blog Post
    Published
    Sept. 20, 2018, 12:17 p.m.
    ...path to science policy and science communication A career in science communication or policy requires broad... is becoming ever more urgent for scientists to engage broadly with diverse communities, to raise awareness...and concerns of these communities. This kind of engagement and two-way dialogue is crucial if we as a society... space of science education, communication, and policy. In this post, I hope to tell you a little more...law enforcement, continues to hamper efforts to engage these communities, including those by researchers...technologies and as societal participants in the political process. My role at pgEd I have always been very...attending seminars in bioethics, public health, science policy, and science and technology studies (STS). I also...
  10. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    Published
    March 21, 2017, 2:30 p.m.
    ...necessary for the production of a viral particle (Gag, Pol, Tat, Rev and Env) and the transfer plasmid encoding...because this vector requires only three HIV-1 genes (gag, pol, and rev) for production. Third generation lentiviral... you will find will recommend using a polycation, like polybrene (protocol) or DEAE dextran (protocol)...
  11. Viral Vectors 101: The Retroviral Lifecycle

    Type
    Blog Post
    Published
    July 27, 2023, 1:15 p.m.
    ...incorporated into HIV-1 particles independently of the Gag/Pol precursor protein. The EMBO Journal, 16(16), 5113...viral vector particles are made while missing the polymerase gene may seem like a mystery. But it’s simple... M., & Bishop, J. M. (1973). RNA-directed DNA polymerase of Rous sarcoma virus: Initiation of synthesis...
  12. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    Published
    July 6, 2021, 1:28 p.m.
    ...replication. They contain two genes: gag and pol. The pol polyprotein encodes the reverse transcriptase ...reading frames (ORFs) which often terminate with a poly(A). ORF2 encodes endonuclease and reverse transcriptase...
  13. Finding Your Science Policy Path

    Type
    Blog Post
    Published
    Sept. 22, 2020, 1:15 p.m.
    ...for science policy folks is on Twitter- start an account and start engaging with the #scipol hashtag. Often... science policy, there is often discussion of “big P” and “little p” policy.  “Big P” policy is what you...about where science policy happens.  When do you do science policy? Many science policy training programs... is science policy?”  I have been asked this many times throughout my short science policy career and ...importantly, how, of a science policy career.  Who does science policy? I’ve intentionally started with... many science policy professionals that entered the field from a more traditional policy background, learning...to start. What is science policy? THE IMPOSSIBLE QUESTION. Science policy is the work you do to creatively...
  14. CRISPR 101: Non-Homologous End Joining

    Type
    Blog Post
    Published
    April 16, 2015, 3:45 p.m.
    ...toolbox of processing factors, including polymerases (Pol μ and Pol λ), nucleases (Artemis), and structure-specific...smegmatis (Yan et al., 2020). NHEJ can also be engaged by variants of the canonical Cas9 approach. A pair...
  15. Hot Plasmids: Spring 2025

    Type
    Blog Post
    Published
    June 3, 2025, 1:15 p.m.
    ...composed of a protein core, 2–4 glycosaminoglycans (GAG), and are (typically) tethered to the cell surface...Modular by design: Key elements (promoter, tag, polyA site) are flanked by unique restriction sites so...general heat-shock proteins using IP with CycT1 or PolII-CTD antibodies and unlabeled MS in DLD-1 cells (...
  16. With an Eye Towards the Future, We Look Back at the March for Science

    Type
    Blog Post
    Published
    Oct. 24, 2017, 1:54 p.m.
    ...interested in global health policy.  He is also chair of the postdoctoral engagement committee and active member... scientists must rise up and become more politically engaged. I was proud to be a part of a community ...approach policy makers take in abusing climate science skepticism to promote harmful policies that benefit...move slowly, news about possible broad changes to policies seems to break everyday. Many researchers and ...participation in government, evidence to inform policies, a protected place to work, funding for science...medicines, technologies, defense, and governing policies are developed primarily by wishful thinking. The...rains, it was weather befitting of the ominous political climate in which American scientists find themselves...
  17. 10 Steps to a Perfect Science Talk

    Type
    Blog Post
    Published
    Aug. 23, 2016, 2:30 p.m.
    ...experiment with other ways to engage the audience. Take an informal poll by asking for a show of hands...of useful, entertaining science lab, career, and policy content. Watch Joanne give her "Not" Networking...the best ways to make you and your presentations engaging and memorable. If you read my story above about... results, striking images, creative ideas, and engaging stories as you encounter or experience them. Drop...almost anyone with enough practice. I always take a poll of scientists in training to see how many in my ...to be conversational - the audience should feel engaged and not like they’re sitting through a pre-recorded...from the speaker, but actually makes for a more engaging session. The best speakers use no notes and can...
  18. Plasmid Cloning by PCR

    Type
    Blog Post
    Published
    March 29, 2016, 2:30 p.m.
    ...use a high fidelity polymerase to minimize mutations. The fidelity of the polymerase becomes more important... million bp depending on the polymerase used. No matter which polymerase you use, it is important that.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Preparing the PCR product for...
  19. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    Published
    March 13, 2014, 4:08 p.m.
    ... and surveyor. Q15: I used DNA polymerase Takara Ex Taq™ DNA Polymerase for my genomic PCR, but couldn't...In our hands, Herculase II Fusion polymerase or Kapa Hifi Polymerase work very well. Some groups have ...your HR by doing Restriction Fragment Length Polymorphism (RFLP) (see Figure 4 of the Cong et. al (2013...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ...
Showing: 1 - 20 of 58 results