We narrowed to 13 results for: hiv gag pol
-
TypeBlog PostPublishedApril 23, 2014, 1:08 p.m....plasmid and a packaging plasmid encoding HIV proteins gag, pol, rev, and tat. 3rd generation systems require...number of HIV genes required for virus production (3 or 4). Third-generation vectors contain gag, pol, and ...gamma-retroviruses use the same genes for packaging (that's gag, pol, and env), the isoforms of these proteins, as ...plasmid, and two packaging plasmids, one encoding gag and pol and a second encoding rev. Secondly, 3rd generation...systems have been developed over the years based on HIV-1; however, the 1st-generation vectors are never ...E1A, which has been shown to repress expression of HIV-1 LTRs (more information is available here). 2nd...a chimeric 5'LTR removes the requirement for the HIV Tat protein, thus decreasing the probability of creating...
-
Lentiviral Vector Uses and Overview
TypeBlog PostPublishedMay 19, 2016, 2:30 p.m....(Figure 2). The HIV genes that do remain are very important for viral production: Gag (structural precursor... plasmids: one encoding Rev and one encoding Gag and Pol, increasing the number of recombination events...precursor protein), Pol (polymerase), Tat (viral transactivator for transcriptional activation from the ...Trono and collaborators turned to the lentivirus HIV-1, well-known to infect non-dividing cells. The first...plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due to a ...plasmid encoded the desired transgene flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral...wide infectivity, is often used as a substitute for HIV-1 Env, which can only infect CD4+ cells. 3rd generation... -
Viral Vectors 101: Gamma-Retroviral Packaging Systems
TypeBlog PostPublishedAug. 6, 2024, 1:15 p.m....Packaging genes (viral Gag-Pol): Gag is a structural precursor protein, and Pol is a polymerase. Envelope gene...γ-retroviruses use the same gene products for packaging (Gag, Pol, and Env), the isoforms of these proteins, as ...utilizes a packaging cell line that stably expresses Gag-Pol and/or Env, eliminating the need to deliver these...Garry Nolan at Stanford (Swift, 2001) contains Gag-Pol and either an ecotropic envelope, Phoenix-ECO, ...days. Another variant, Phoenix-gp, contains only Gag-Pol and enables additional flexibility in pseudotyping...lentiviruses and standard γ-retroviruses use the Gag, Pol, and Env genes for packaging; however, they are...different genomes (MoMLV and MSCV for γ-retrovirus; HIV for lentivirus). Additionally, γ-retroviruses can... -
Quick Guide to All Things Lentivirus
TypeBlog PostPublishedMarch 21, 2017, 2:30 p.m....because this vector requires only three HIV-1 genes (gag, pol, and rev) for production. Third generation...necessary for the production of a viral particle (Gag, Pol, Tat, Rev and Env) and the transfer plasmid encoding...family including human immunodeficiency virus type-1 (HIV-1), can infect both dividing and non-dividing cells... have been devoted to develop efficient and safe HIV-1-derived lentiviral vectors due to their ability...the desired gene (transfer vector plasmid), 2) the HIV-1 genome containing all viral genes with the exception...lentiviruses (RCL) especially if you are working on HIV positive human cell from the clinic. The 2nd generation...similar to the first one with the exception that the HIV accessory proteins that are not essential for the... -
Viral Vectors 101: The Retroviral Lifecycle
TypeBlog PostPublishedJuly 27, 2023, 1:15 p.m.... RT and IN incorporated into HIV-1 particles independently of the Gag/Pol precursor protein. The EMBO ...Gamma-retrovirus genome (left) and an HIV lentiviral genome (right.) HIV seems an unlikely candidate for...Retroviridae (commonly called retrovirus) family — of which HIV is a member — may seem like an unlikely candidate...subclass of retroviruses called the lentiviruses (like HIV-1) — that have been developed into lentiviral vectors... cause cancer via insertional mutagenesis (which HIV does not do). Furthermore, molecular biologists working...viral vector particles are made while missing the polymerase gene may seem like a mystery. But it’s simple... M., & Bishop, J. M. (1973). RNA-directed DNA polymerase of Rous sarcoma virus: Initiation of synthesis... -
15 Years of Addgene: The Top 15 Plasmids
TypeBlog PostPublishedJan. 8, 2019, 1:54 p.m....from the Didier Trono lab that expresses the HIV gag, pol, rev, and tet genes. It can be used with 2nd...plasmid from the Trono lab that contains the gag and pol genes. It also requires pRSV-Rev and the envelope... -
Viral Vectors 101: Integrase-Deficient Lentiviral Vectors
TypeBlog PostPublishedMay 13, 2025, 1:15 p.m....plasmid contains Gag, Pol, Rev, and Tat genes. Specifically for our knowledge here, the Pol gene encodes ...were first discovered by researchers investigating HIV integrase mutants in the early 1990s (Leavitt et ..., Berry, C., Ecker, J. R., & Bushman, F. (2002). HIV-1 integration in the human genome favors active genes...19491821 PubMed Central PMCID: PMC2835240 Wu Y. (2004). HIV-1 gene expression: lessons from provirus and non-... -
Plasmids 101: Terminators and PolyA signals
TypeBlog PostPublishedMarch 31, 2016, 2:30 p.m....constitutive RNA transport element lead to enhanced HIV-1 Gag expression in a context-dependent manner. Nucleic... both polyadenylation and termination. Out of those listed, the SV40 late polyA and rbGlob polyA are thought...any 3’ regulatory elements, such as the polyadenylation or poly(A) signal. While many studies focus on ...purpose and mechanism of polyadenylation vary across cell types, but polyadenylation generally serves to promote...consensus sequence for the addition of a poly(A) tail, the addition of a poly(A) tail on a prokaryotic transcript... termination and polyadenylation Unlike prokaryotes that have a single RNA polymerase for transcription...transcription, eukaryotes have three RNA polymerases (Polymerases I, II, and III), each responsible for transcribing... -
Plasmids 101: Using Transposons in the Lab
TypeBlog PostPublishedJuly 6, 2021, 1:28 p.m....replication. They contain two genes: gag and pol. The pol polyprotein encodes the reverse transcriptase ...sites. This is similar to how retroviruses, like HIV, replicate. Class I TEs do not encode a transposase...reading frames (ORFs) which often terminate with a poly(A). ORF2 encodes endonuclease and reverse transcriptase... -
Antibodies 101: Single Chain Fragment Variables (scFvs)
TypeBlog PostPublishedJune 3, 2021, 1:15 p.m.... the prevention or treatment of HIV infection. Current Opinion in HIV and AIDS 10:190–197 . https://doi.org...could be useful for delivering scFvs that inhibit HIV. References and Resources References: Ahmad ...recombinant antibody. They are ~25 kDa single polypeptides that contain the variable light chain (VL) and...When these molecules, called Bispecific T-cell engagers (BiTE®s), bind CD3 on T cells and a tumor-specific... -
With an Eye Towards the Future, We Look Back at the March for Science
TypeBlog PostPublishedOct. 24, 2017, 1:54 p.m....He studies viruses including HIV and is interested in global health policy. He is also chair of the postdoctoral... scientists must rise up and become more politically engaged. I was proud to be a part of a community ...approach policy makers take in abusing climate science skepticism to promote harmful policies that benefit...move slowly, news about possible broad changes to policies seems to break everyday. Many researchers and ...participation in government, evidence to inform policies, a protected place to work, funding for science...medicines, technologies, defense, and governing policies are developed primarily by wishful thinking. The...rains, it was weather befitting of the ominous political climate in which American scientists find themselves... -
CRISPR/Cas9 FAQs Answered!
TypeBlog PostPublishedMarch 13, 2014, 4:08 p.m.... and surveyor. Q15: I used DNA polymerase Takara Ex Taq™ DNA Polymerase for my genomic PCR, but couldn't...In our hands, Herculase II Fusion polymerase or Kapa Hifi Polymerase work very well. Some groups have ...your HR by doing Restriction Fragment Length Polymorphism (RFLP) (see Figure 4 of the Cong et. al (2013...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ...10.1016/j.cell.2011.06.019 Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F...10.1016/j.cell.2013.04.025 Yang, H., Wang, H., Shivalila, C. S., Cheng, A. W., Shi, L., & Jaenisch, R. ... -
The Challenges of Cell Culture
TypeBlog PostPublishedMay 5, 2016, 2:30 p.m....sharing cells: the black market of cell biology. Engaging in this practice would seem to save time and money...whether the cell lines had isoenzymes and genetic polymorphisms specific to their origins. This technique is..., HeLa cells, and cell culture contamination." Archives of pathology & laboratory medicine 133.9 (2009...