Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 30 results for: tet on

Showing: 1 - 10 of 30 results

  1. Tetracycline Inducible Expression

    Type
    Collection
    ... of tet-responsive systems: Tet-Off and Tet-On. Read on to learn more about the components of tet systems... center: Tet-Off; right: Tet-On. TRE: Tet response element; tTA: tetracycline-controlled transactivator... Plasmid Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression ...shown. Tetracycline Off (Tet-Off) The first major advance was the Tet-Off system. A tetracycline-controlled...conditions, the TetR protein binds to tet O, blocking transcription of the downstream gene. If tet or one of...highlighted Tet plasmids . Figure 1: Tet-regulated expression systems. Left: natural TetR mechanism; center...known as the tTA-dependent or tet-repressible system. Tetracycline On (Tet-On) In 1995, Gossen et al. used...

  2. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible ...vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...Expresses ultraID in mammalian cells with the Tet-On or Tet-Off system Return to top Selectable Markers ...Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression Find...Neomycin selection Puromycin Mammalian Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...vector with N- or C-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF expression...vector for gene expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector for...

  3. AAV Molecular Tools

    Type
    Collection
    ...tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible expression...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1... available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback...Overexpression Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible tools...

  4. Lentivirus Plasmids

    Type
    Collection
    ...14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-pLKO-puro 3rd inducible expression of shRNA; puromycin...EF-1a-driven GFP and shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB...cDNA. Puro selection. Shih 25737 pSLIK-Hygro 3rd Tet-based inducible shRNA or cDNA expression, gateway... other versions of pSLIK. Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression...versions of this plasmid. Root 44012 pInducer20 3rd Tet-inducible lentivirus for ORF expression, multicistronic...See plasmid 21374 for dtomato version. Welm 21916 Tet-pLKO-neo 3rd inducible expression of shRNA; neomycin...

  5. Plasmid Collections

    Type
    Collection
    ...Microbiology Plant Expression Stem Cells Synthetic Biology Tet Inducible Expression Worm Expression Kits Kits are...

  6. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ...strain expressing two reporters and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment...allows for quick integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed...

  7. Mammalian RNAi Tools

    Type
    Collection
    ...that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To find plasmids containing...

  8. Retrovirus Plasmids

    Type
    Collection
    ...retroviral plasmid Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA; expresses rtTA. See...resistance. Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in...

  10. Validated gRNA Sequences

    Type
    Collection
    ...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...
Showing: 1 - 10 of 30 results