...pAAV-Syn-Archon1-KGC-GFP-ER2 Syn Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn...9 Li Voltage Reporter: Archon 108422 pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent...Syn Archon1 EGFP Cre dependent 8 Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn...Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter: JEDI-2P 179459 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE ...HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1, 9 Schreiter Calcium Sensor...HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1, 9 Schreiter Dopamine Sensors...Ready-to-use AAV available from Addgene's viral service encoding biosensor tools, including calcium sensors...

...listed below. When targeting other gene loci, you will prepare the gene-specific CRISPR and donor vectors...FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen...multiple genes. Plasmids can be found associated with the following article: Paix, et al. Genetics 2014 Allen...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...repair template design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System ... the plasmids as listed in each row. If your own gene of interest is currently unavailable, you will need...terminal affinity tag (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This...

...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV...top Plasmids Encoding Mammalian Genes or Inserts Several mammalian genes have been identified as having...to these genes below. ID Plasmid Description Industry PI For more information on these genes, see the ... lists several luciferase and fluorescent reporter plasmids that have been used for measuring viral entry...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...(Link opens in a new window) CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ...

...zebrafish gene of interest? Search Addgene's collection for plasmids that contain a zebrafish gene or sequence...control of gene expression in zebrafish using red light. LipoGlo - Steven Farber Lab. A reporter system that...zebrafish-specific gene expression database that provides information about when genes are active in developing...developing embryos. zfRegeneration - A database for gene expression profiling during regeneration. Seurat - R ...-type specific conditional gene inactivation - Jeffrey Essner Lab GeneWeld Vectors for Targeted Integration...ranging from optogenetics to tools for studying diseases, are listed below: Lipid droplet reporters - Richard... finger nucleases, TALENS, and CRISPR/Cas9-based gene editing make the zebrafish a stalwart research model...

...remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene from the EF1 promoter...vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious virus...the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter ... 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...

...possible deletion strategies for genes and non-coding elements. For creating a gene knockout, two sgRNA located...evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene 7,8 . To evaluate the protein, perform...genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple... as pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP and puromycin...for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines. Protocol...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...transfection conditions for each cell line with a reporter construct to ensure robust plasmid delivery before...

...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...

...plasmids for the EGFP Reporter Gene Guide RNA expression plasmids for endogenous human genes Guide RNA expression...these vectors for efficiently modifying endogenous genes in zebrafish (Hwang and Fu et al., Nat Biotechnol...expression plasmids for endogenous zebrafish genes...

...Endogenous Zebrafish Genes TALENs for Endogenous Human Genes TALENs for the EGFP Reporter Gene Additional Plasmids...transcriptional activator target sites and then generates individual user-friendly graphical roadmaps for...

... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi...highest levels of single-gene activation (Figure 9D) In bacteria, activating gene expression is more difficult... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...

...MiniPromoter Source Gene Construct Reporter Negative Control N/A pEMS1312 cre N/A pEMS1301 cre/EGFP/NLS N/A pEMS1308... disorders by enabling region- and cell-specific gene-delivery in the mouse brain through these human ...pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS N/A pEMS1306 EGFP/NLS N/A pEMS1307 EGFP/NLS N/A pEMS1313 intron-lacZ...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS...