We narrowed to 29 results for: GFP reporter gene
-
TypeCollection...listed below. When targeting other gene loci, you will prepare the gene-specific CRISPR and donor vectors...FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen...multiple genes. Plasmids can be found associated with the following article: Paix, et al. Genetics 2014 Allen...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...repair template design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System ... the plasmids as listed in each row. If your own gene of interest is currently unavailable, you will need...terminal affinity tag (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This...
-
Tetracycline Inducible Expression
TypeCollection...promoter upstream of your gene of interest. If your gene of interest should be generally active and only turned...Iwasato 63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase...Tet-On Systems for Doxycycline-inducible Gene Expression . Curr Gene Ther, 16 (3), 156–167. https://doi.org...Tet-On system for regulated gene expression through viral evolution . Gene Ther, 13 (19), 1382–1390. https...downstream gene via its activation domain than simply removing the repressor. 2nd and 3rd Generation Systems...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS... -
Validated gRNA Sequences
TypeCollection...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application... -
Zebrafish Plasmid Collection
TypeCollection...zebrafish gene of interest? Search Addgene's collection for plasmids that contain a zebrafish gene or sequence...control of gene expression in zebrafish using red light. LipoGlo - Steven Farber Lab. A reporter system that...zebrafish-specific gene expression database that provides information about when genes are active in developing...developing embryos. zfRegeneration - A database for gene expression profiling during regeneration. Seurat - R ...-type specific conditional gene inactivation - Jeffrey Essner Lab GeneWeld Vectors for Targeted Integration...ranging from optogenetics to tools for studying diseases, are listed below: Lipid droplet reporters - Richard... finger nucleases, TALENS, and CRISPR/Cas9-based gene editing make the zebrafish a stalwart research model... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection... Depositor Collections Gene Vector Core Viral Vectors Gene Vector Core Viral...remove genes flanked by either loxP or FRT sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene from the EF1 promoter...vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious virus...the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter ... -
Fluorescent Proteins: FRET
TypeCollection...single-nanometer scale, scientists can use FRET to report on protein binding or conformational changes. Organic...your experiment, be sure to refer to published reports and include appropriate controls to help interpret...sREACh-C1 , mGFP-10-sREACh-N3 EGFP ShadowY** 488 0.6 531** 136,000 0.01 6.1 4.5 mEGFP-N1 , CMV-ShadowY , EGFP-ShadowY...(λ) Plasmids mTagBFP sfGFP 399 0.64 510 83,000 0.65 4.6 2.6 mTagBFP2-pBAD , sfGFP-pBAD ECFP EYFP 434 0.41...mTFP1-N1 , mCitrine-pBAD EGFP mCherry 488 0.60 610 72,000 0.22 5.3 1.9 mEGFP-N1 , mCherry2-N1 , pcDNA3.1...sReach-mTurquoise2 EGFP sREACh** (super-REACh, aka Nữ) 488 0.60 531** 115,000 0.07 6.0 4.1 mEGFP-N1 , sREACh-...Fixed Cells Additional Resources at Addgene Learn more on the Addgene Blog: Introduction to FRET and Tips... -
TALEN Engineering
TypeCollection...Endogenous Zebrafish Genes TALENs for Endogenous Human Genes TALENs for the EGFP Reporter Gene Additional Plasmids...transcriptional activator target sites and then generates individual user-friendly graphical roadmaps for... -
CRISPR Guide
TypeCollection... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Targeting dCas9 to transcription...single-gene activation (Figure 9D) Figure 9: Overview of CRISPRi/a. In bacteria, activating gene expression... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have... -
The Pleiades Promoter Project
TypeCollection...MiniPromoter Source Gene Construct Reporter Ple2 ADORA2A pEMS1142 EGFP/NLS Ple3 ADORA2A pEMS1143 EGFP/NLS Ple3 ADORA2A... disorders by enabling region- and cell-specific gene-delivery in the mouse brain through these human ...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS...pEMS1216 EGFP/NLS Ple99 GRP pEMS1371 EGFP/NLS Ple100 GRP pEMS1372 EGFP/NLS Ple101 GRP pEMS1373 EGFP/NLS Ple102...