We narrowed to 28 results for: ef1;
-
TypeCollection...Mammalian Gibson none S. pyogenes Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes...Lentiviral BsmBI yes, cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S...
-
Brzezinski Lab CRISPR Collection
TypeCollection...modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter variant nuclear... -
Lentiviral Prep Service
TypeCollection...encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE) Zhang Pooled... -
Arf GTPase Family
TypeCollection...Bacterial (pGEX4T), Mammalian (pEGFP-N3), Gateway GEF Arfgef1 (BIG1, ARFGEP1) 10565 1849 Mammalian (pcDNA4c, ... -
Ras Pathway
TypeCollection...guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide exchange factor ... -
Immunology Research Plasmids and Resources
TypeCollection...Dfy, FY, GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin...phosphoribosyltransferase 1110035O14Rik, DKFZp666B131, MGC117256, PBEF, PBEF1, VF, VISFATIN NDP Norrie disease (pseudoglioma) ... -
Zhang Lab CRISPR Page
TypeCollection...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites for ... -
Validated gRNA Sequences
TypeCollection...TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae TTGATATTTAAGTTAATAAA 46922 interfere...