Skip to main content
Addgene

We narrowed to 105 results for: tro

Showing: 21 - 40 of 105 results
  1. AAV Packaged on Request

    Type
    Collection
    ...facilitation, DNA amplification, and high-quality quality control measures such as titering, purity assessment, sterility...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy ...serotype? Learn more about AAV serotypes and tissue tropism on Addgene's blog . All-in-One Pricing The price...centrifugation purification Addgene’s comprehensive quality control process: Titering Purity assessment Sterility testing...produce the prep, and perform comprehensive quality control processes to make sure it is ready for your experiments...your AAV vector experience, from methods to troubleshooting insights, you make research more reproducible...gap between published methods and real-world troubleshooting. Eligible Plasmids The following plasmids are...
  2. Antibody Production

    Type
    Collection
    ... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...are initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...
  3. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...81070 rAAV2-retro helper AAV retrograde AAV packaging plasmid, expressing Rep2 and retrograde capsid Alla...non-standard), expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Viviana Gradinaru...(non-standard), expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Viviana Gradinaru...non-standard), expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...plasmid (non-standard), expressing Rep2 and B10 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...plasmid (non-standard), expressing Rep2 and B22 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...non-standard), expressing Rep2 and MaCPNS1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...
  4. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...given donor-acceptor pair, the FRET efficiency strongly depends on the distance between the donor and ...linker-Cerulean-5aa linker-Venus-6aa linker-Venus V5V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 5 amino acid linker V17V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 17 amino acid linker V32V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 32 amino acid linker VVV Anisotropy/brightness standard consisting of three Venus... 5 and 6 amino acid linker, respectively VVVV Anisotropy/brightness standard consisting of four Venus ...5 and 6 amino acid linker, respectively VVVVV Anisotropy/brightness standard consisting of five Venus ...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14666 pQE9-His-p97...T7 Parkinson's Dmytro Yushchenko 107293 s2. pT7-7-SNCA-5Asp SNCA T7 Parkinson's Dmytro Yushchenko 107294... T7 Parkinson's Dmytro Yushchenko 107295 r. pT7-7-SNCA-5Asn SNCA T7 Parkinson's Dmytro Yushchenko 107296...T7 Parkinson's Dmytro Yushchenko 107297 r-22. pT7-7-SNCA-9Asn SNCA T7 Parkinson's Dmytro Yushchenko 107425...neuroaxonal dystrophy Michael Ward 178167 RNF216_Halo_C_allele RNF216 Halo Hypogonadotropic hypogonadism...Ataxia Pietro De Camilli 194005 VPS13D1-1576-(Y1253S) VPS13D GFP CMV Spinocerebellar Ataxia Pietro De Camilli...Parkinsonism Pietro De Camilli 232865 mCherry-VAB(VPS13C) VPS13C mCherry CMV Parkinsonism Pietro De Camilli...
  6. Bacterial Expression Systems

    Type
    Collection
    ...visualization, study of protein interactions, controlled gene expression, reporter plasmids and genome...Purification Protein Visualization Protein Interactions Controlled Expression Reporter Plasmids Genome Engineering...arrays of zinc finger nucleases. Addgene Blog Introduction to FRET Bimolecular Fluorescence Complementation...Studying Protein–Protein Interactions Return to top Controlled Expression It isn’t always advantageous to constitutively...stationary phase. In these cases, you may want to control protein levels or to turn on expression only at...contains plasmids whose expression levels can be controlled by a variety of small molecules, light, and temperature...C) Escherichia coli Yingfeng An Other Addgene Controlled Expression Resources Check out our Tetracycline...
  7. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...systems, how to use them to modify the genome or control gene expression, and find plasmids for your experiments...engineering tools used to precisely manipulate DNA and control the expression of specific genes in cells or organisms...recombinases can be used to modify the genome or control gene expression or skip ahead to browse highlighted...Summary of Cre, Dre, and Flp Recognition Sites. Controlling Recombinase Expression By expressing the enzyme...promoters or inducible systems, you can precisely control and optimize expression of your gene of interest...fused to a ligand-binding domain such as the human estrogen receptor (ERT2) so that the enzyme is only activated... and C-terminal fragments and placed under the control of different promoters. Expression of both fragments...
  8. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Image from Fenno et al., 2014. INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting...and Flp) recognition sequences within synthetic introns. INTRSECT was first shown as a proof-of-concept...transgenic recombinase-expressing animal lines and retro-grade expressing viruses delivering additional recombinases.... Figure 2: INTRSECT works by inserting short, intronic sequences into the open reading frame (ORF) of...sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The addition of these recombinase recognition...recognition sequences enables directional control of the portion of the ORF that is sandwiched between the... combinations of recombinases are present, the introns are excised during mRNA processing, producing a...
  9. CRISPR Guide

    Type
    Collection
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...
  10. Serotype Testing AAV

    Type
    Collection
    ...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype ... AAV2, AAV5, AAV6, AAV8, AAV9, AAV11, and AAV retrograde....fluorescent reporters and can be used to compare the tropism of different serotypes. In addition to the standard...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized... catalog item, including the titer and quality control, visit the material page (linked for each catalog...AAV11 37825-AAV11.T 20 µL $ 150 Add to Cart AAV Retrograde 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP...
  11. CRISPR Plasmids - Drosophila

    Type
    Collection
    ... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...49410 pCFD3-dU6:3gRNA dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...
  12. Plan Your Experiment

    Type
    Collection
    ...CRISPR Experiment Jump To: Plan Your Experiment Introduction Select Genetic Manipulation Design and Clone...CRISPR experiments and can be used as positive controls when working out a new protocol. Read more about...generally perform by chemical transfection or electroporation. Expression can be transient, or you can generate... of Cas and gRNA. This method involves using in vitro transcription reactions to generate mature Cas mRNA... to target cells through microinjection or electroporation. The target cells translate the mRNA encoding...you directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You...delivery the RNP to cells using cationic lipids, electroporation, or an endosomal approach. Similar to the mRNA...
  13. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...test the function of your gene of interest in a controlled environment under various conditions. When choosing...tag for mammalian expression (Gateway) pYIC - Bicistronic fluorescent reporter gene with cap-dependent ...expression, see our dedicated Lentiviral Plasmids page Retroviral Easy and safe to use, integrate into host genome...MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable... production AAV-GfaABC1D-MCS--4x6T-WPRE - For astrocyte-selective expression in AAV Dual promoter Separate...transient expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP...
  14. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... 10 6 cells in 100 μl of electroporation solution and add to electroporation cuvette. Add 5 μg of each...construct. Electroporate cells with 250 volts for 5 msec in a 2 mm cuvette using an electroporation system...of culture media after electroporation. Minimize the time between electroporation and transferring the ...manuscript here: Bauer et al, 2014 322.2 KB If you have trouble loading this video, please try viewing on YouTube...involves the delivery of CRISPR/Cas9 plasmids by electroporation 4 . This protocol is described in detail for...Li D, Li J. Cell Stem Cell . 2013. PubMed . Electroporation: theory and methods, perspectives for drug ...
  15. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...
  16. AAV Viral Preps

    Type
    Collection
    ...samples of control AAV vectors for trial purposes in serotypes AAV1, 2, 5, 6, 8, 9, 11, and retrograde Retrograde...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy .... Addgene’s comprehensive high-quality quality control process includes titering, purity assessment, sterility... Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster, Brainbow...
  17. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...intracerebroventricular (ICV) delivery in newborns, and retro-orbital (RO) and stereotaxic (STX) delivery in adult...minBG-SYFP2-WPRE3-BGHpA AiP14470 AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531...minBG-SYFP2-WPRE3-BGHpA AiP12558 AiE0390m_3xC2 SYFP2 Astrocytes Whole Brain 208163 pAAV-AiE0390m_3xC2-minBG-iCre...-iCre(R297T)-BGHpA AiP14801 AiE0390m_3xC2 Cre Astrocytes Whole Brain 208143 pAAV-AiE0390h_3xC2-minBG-SYFP2...minBG-SYFP2-WPRE3-BGHpA AiP13572 AiE0390h_3xC2 SYFP2 Astrocytes Whole Brain 208133 pAAV-AiE0387m-minBglobin-SYFP2...-SYFP2-WPRE3-BGHpA AiP12102 AiE0387m SYFP2 Astrocytes Whole Brain 208166 pAAV-AiE0387m-minBG-iCre(R297T...R297T)-BGHpA AiP13999 AiE0387m Cre Astrocytes Whole Brain 220643 pAAV-AiE2128m-minBG-SYFP2-WPRE3-BGHpA AiP1357...
  18. Zebrafish Plasmid Collection

    Type
    Collection
    ...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...horizontal stripes on the sides of the adult body, is a tropical freshwater fish in the minnow family. It has long...refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology or the zebrafish CRISPR...ALS-linked aggregates in real time. Live imaging of astroctyes - Kelly Monk Lab. Live imaging tools to study...study the development and function of zebrafish astrocytes. Knock-in tagging - Michel Bagnat lab. Targeting...
  19. TALEN Plasmids and Kits

    Type
    Collection
    ...expression is driven by the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7...promoter. RCIscript-GoldyTALEN is designed for in vitro synthesis of TALEN mRNAs. Both 5’ and 3’ Xenopus...of the DNA-binding domain of a TALE, along with strong nuclear localisation tags and repress transcription... T7 promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which ... included for generating TALEN mRNAs through in vitro transcription as an alternative. Based on transient...
  20. Neurodegeneration Research Collection

    Type
    Collection
    ...collections available at Addgene. Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS), sometimes...being adopted in the field. Read on for a brief introduction to the genetics associated with some of the ...Symptoms include changes in behavior and emotion, uncontrolled movements, memory deficits, as well as difficulty...neurons in the substantia nigra, one of the movement control centers in the brain. The cause of this neuron ...Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human...
Showing: 21 - 40 of 105 results