Skip to main content
Addgene

We narrowed to 106 results for: tro

Showing: 21 - 40 of 106 results
  1. Bacterial Expression Systems

    Type
    Collection
    ...function under a wide range of highly controlled conditions in vitro , or, if you want to determine its ...Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids...Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may also like… ...produce large amounts of this protein and study it in vitro ? These, in addition to many questions about bacteria..., sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome...Manipulating the genome directly can give you more subtle control over protein expression and activity thereby limiting...Dammeyer Lactose/IPTG inducible vectors with LacIq, a stronger repressor than LacI that lowers basal protein ...
  2. Antibody Production

    Type
    Collection
    ... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...are initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...
  3. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...81070 rAAV2-retro helper AAV retrograde AAV packaging plasmid, expressing Rep2 and retrograde capsid Alla...non-standard), expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Viviana Gradinaru...(non-standard), expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Viviana Gradinaru...non-standard), expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...plasmid (non-standard), expressing Rep2 and B10 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...plasmid (non-standard), expressing Rep2 and B22 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...non-standard), expressing Rep2 and MaCPNS1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru...
  4. AAV Packaged on Request

    Type
    Collection
    ...facilitation, DNA amplification, and high-quality quality control measures such as titering, purity assessment, sterility...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy ...centrifugation purification Addgene’s comprehensive quality control process: Titering Purity assessment Sterility testing...produce the prep, and perform comprehensive quality control processes to make sure it is ready for your experiments...your AAV vector experience, from methods to troubleshooting insights, you make research more reproducible...gap between published methods and real-world troubleshooting. Eligible Plasmids The following plasmids are...including purification, titration, and quality control measures. We have distributed preps around the ...
  5. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...given donor-acceptor pair, the FRET efficiency strongly depends on the distance between the donor and ...linker-Cerulean-5aa linker-Venus-6aa linker-Venus V5V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 5 amino acid linker V17V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 17 amino acid linker V32V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 32 amino acid linker VVV Anisotropy/brightness standard consisting of three Venus... 5 and 6 amino acid linker, respectively VVVV Anisotropy/brightness standard consisting of four Venus ...5 and 6 amino acid linker, respectively VVVVV Anisotropy/brightness standard consisting of five Venus ...
  6. Viral Vectors

    Type
    Collection
    ...expression. γ-Retrovirus Plasmids | Guide γ-retroviruses, commonly referred to as retroviruses, are the most...integration. Community Resources Nolan Lab Retroviral Systems Trono Lab Lentivector Toolbox Guide to Generating...Adenoviruses are commonly used as vaccines because of the strong immunogenic response they induce. Some (oncolytic...this infectivity is limited to dividing cells. Retroviruses integrate permanently into the host genome, ...virus (as happens in nature), researchers can introduce plasmids to a host to generate virus. Furthermore...DNA >8 Kb 105 Dividing/Non-dividing No High γ-Retrovirus Stable RNA <8 Kb 80-130 Dividing Yes Moderate...
  7. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Image from Fenno et al., 2014. INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting...and Flp) recognition sequences within synthetic introns. INTRSECT was first shown as a proof-of-concept...transgenic recombinase-expressing animal lines and retro-grade expressing viruses delivering additional recombinases.... Figure 2: INTRSECT works by inserting short, intronic sequences into the open reading frame (ORF) of...sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The addition of these recombinase recognition...recognition sequences enables directional control of the portion of the ORF that is sandwiched between the... combinations of recombinases are present, the introns are excised during mRNA processing, producing a...
  8. CRISPR Guide

    Type
    Collection
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...
  9. CRISPR Plasmids - Drosophila

    Type
    Collection
    ... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...49410 pCFD3-dU6:3gRNA dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...
  10. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14666 pQE9-His-p97...T7 Parkinson's Dmytro Yushchenko 107293 s2. pT7-7-SNCA-5Asp SNCA T7 Parkinson's Dmytro Yushchenko 107294... T7 Parkinson's Dmytro Yushchenko 107295 r. pT7-7-SNCA-5Asn SNCA T7 Parkinson's Dmytro Yushchenko 107296...T7 Parkinson's Dmytro Yushchenko 107297 r-22. pT7-7-SNCA-9Asn SNCA T7 Parkinson's Dmytro Yushchenko 107425...neuroaxonal dystrophy Michael Ward 178167 RNF216_Halo_C_allele RNF216 Halo Hypogonadotropic hypogonadism...Ataxia Pietro De Camilli 194005 VPS13D1-1576-(Y1253S) VPS13D GFP CMV Spinocerebellar Ataxia Pietro De Camilli...research related to Alzheimer's Disease (AD), Amyotrophic Lateral Sclerosis (ALS), Frontotemporal dementia...
  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...test the function of your gene of interest in a controlled environment under various conditions. When choosing...tag for mammalian expression (Gateway) pYIC - Bicistronic fluorescent reporter gene with cap-dependent ...expression, see our dedicated Lentiviral Plasmids page Retroviral Easy and safe to use, integrate into host genome...MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable... production AAV-GfaABC1D-MCS--4x6T-WPRE - For astrocyte-selective expression in AAV Dual promoter Separate...transient expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP...
  12. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... 10 6 cells in 100 μl of electroporation solution and add to electroporation cuvette. Add 5 μg of each...construct. Electroporate cells with 250 volts for 5 msec in a 2 mm cuvette using an electroporation system...of culture media after electroporation. Minimize the time between electroporation and transferring the ...manuscript here: Bauer et al, 2014 322.2 KB If you have trouble loading this video, please try viewing on YouTube...involves the delivery of CRISPR/Cas9 plasmids by electroporation 4 . This protocol is described in detail for...Li D, Li J. Cell Stem Cell . 2013. PubMed . Electroporation: theory and methods, perspectives for drug ...
  13. Serotype Testing AAV

    Type
    Collection
    ...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype ...fluorescent reporters and can be used to compare the tropism of different serotypes. In addition to the standard...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized... catalog item, including the titer and quality control, visit the material page (linked for each catalog...AAV9 37825-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP...AAV9 50465-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 50465-AAVrg.T 20 µL $ 140 Add to Cart *Each viral...
  14. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...
  15. AAV Viral Preps

    Type
    Collection
    ... of control AAV vectors for trial purposes in serotypes AAV1, 2, 5, 8, 9 and retrograde Retrograde AAV...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy .... Addgene’s comprehensive high-quality quality control process includes titering, purity assessment, sterility... Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster, Brainbow...
  16. Plan Your Experiment

    Type
    Collection
    ...viral delivery RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA... to target cells through microinjection or electroporation Transient expression of CRISPR components Expression...ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA...repaired DSBs): For small nucleotide edits that introduce a novel restriction site. The region of interest...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA delivery into the...enables efficient protein-based genome editing in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80...
  17. AAVED

    Type
    Collection
    ...targeted neuronal manipulation (aka intersectional control). The end result of the meeting will be a publicly... AM Cre and Flpo Katherine Matho 10:15 AM AAV Retrograde Tracing Gowan Tervo and Sarada Viswanathan 11...tips for using the technology in the lab (e.g., controls to perform, recommended histology conditions, ... examples of AAV strategies for intersectional control. Please see our list of suggested materials below...of research materials to share: In vivo data: Retrograde hSyn1-GCaMP6f-P2A-nls-dTomato Detailed protocol...reference for AAV use in neuronal intersectional control. Through your participation in this meeting, you...
  18. Zebrafish Plasmid Collection

    Type
    Collection
    ...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...horizontal stripes on the sides of the adult body, is a tropical freshwater fish in the minnow family. It has long...refer to Addgene's CRISPR Guide for a general introduction to CRISPR technology or the zebrafish CRISPR...ALS-linked aggregates in real time. Live imaging of astroctyes - Kelly Monk Lab. Live imaging tools to study...study the development and function of zebrafish astrocytes. Knock-in tagging - Michel Bagnat lab. Targeting...
  19. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...intracerebroventricular (ICV) delivery in newborns, and retro-orbital (RO) and stereotaxic (STX) delivery in adult...minBG-SYFP2-WPRE3-BGHpA AiP14470 AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531...minBG-SYFP2-WPRE3-BGHpA AiP12558 AiE0390m_3xC2 SYFP2 Astrocytes Whole Brain 208163 pAAV-AiE0390m_3xC2-minBG-iCre...-iCre(R297T)-BGHpA AiP14801 AiE0390m_3xC2 Cre Astrocytes Whole Brain 208143 pAAV-AiE0390h_3xC2-minBG-SYFP2...minBG-SYFP2-WPRE3-BGHpA AiP13572 AiE0390h_3xC2 SYFP2 Astrocytes Whole Brain 208133 pAAV-AiE0387m-minBglobin-SYFP2...-SYFP2-WPRE3-BGHpA AiP12102 AiE0387m SYFP2 Astrocytes Whole Brain 208166 pAAV-AiE0387m-minBG-iCre(R297T...R297T)-BGHpA AiP13999 AiE0387m Cre Astrocytes Whole Brain 220643 pAAV-AiE2128m-minBG-SYFP2-WPRE3-BGHpA AiP1357...
  20. TALEN Plasmids and Kits

    Type
    Collection
    ...expression is driven by the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7...promoter. RCIscript-GoldyTALEN is designed for in vitro synthesis of TALEN mRNAs. Both 5’ and 3’ Xenopus...of the DNA-binding domain of a TALE, along with strong nuclear localisation tags and repress transcription... T7 promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which ... included for generating TALEN mRNAs through in vitro transcription as an alternative. Based on transient...
Showing: 21 - 40 of 106 results