We narrowed to 45 results for: INO
-
TypeCollection...in a new window) Marcinkiewcz CA, Mazzone CM, D'Agostino G, Halladay LR, Hardaway JA, DiBerto JF, Navarro...
-
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...product should be translated as a single string of amino acids that preserves the sequence of your gene... -
Plasmids for Stem Cell Research
TypeCollection... reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol... -
Validated gRNA Sequences
TypeCollection...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S... -
Cre-lox system
TypeCollection...vector for Pax7 Tanaka 111187 pBADZ-HisCre Cre; arabinose inducible. PBAD promoter Bacterial Richmond 112614...