We narrowed to 46 results for: INO
-
TypeCollection... receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor (NCoR/SMRT) ...
-
Deisseroth INTRSECT Collection
TypeCollection...in a new window) Marcinkiewcz CA, Mazzone CM, D'Agostino G, Halladay LR, Hardaway JA, DiBerto JF, Navarro... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...product should be translated as a single string of amino acids that preserves the sequence of your gene... -
Plasmids for Stem Cell Research
TypeCollection... reprogramming of fibroblasts to expandable, myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol... -
Tetracycline Inducible Expression
TypeCollection... et al. used random mutagenesis to identify the amino acid residues of TetR that were important for tetracycline-dependent... -
Validated gRNA Sequences
TypeCollection...GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S...