Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR header icon Validated gRNA Target Sequences

The table below lists gRNA sequences that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences provided to us by users (see below for more details). Keep in mind that additional factors must be considered before using a validated gRNA sequence in your particular experiment, so make sure to check out the particular conditions of the experiment as described in the associated article (listed below by PubMed ID). These factors include:

  • Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA sequence and your genomic target may reduce the gRNA activity. Know your target.

  • Which species or variant of Cas9 (S. pyogenes, S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible with a single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with targets that are upstream of a 5' NGG 3' PAM sequence).

  • Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets within promoters. When possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish.

Validated gRNA Sequence Datatable

Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor
OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu
OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799 Otonkoski
AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves
AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722 Church
AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini
AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini
AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes 23287722 Church
actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462 Jiang
ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017 Zaratiegui
ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017 Zaratiegui
ade6+ S. pombe TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017 Zaratiegui
Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura
Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini
ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286 Voytas
APC H. sapiens GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto
apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes 23360964 Joung
ASCL1 H. sapiens TGGATGGAGAGTTTGCAAGGAGC 64131 activate S. pyogenes 25619936 Sato
ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG 64130 activate S. pyogenes 25619936 Sato
ASCL1 H. sapiens TGGGGCTGGGTGTCCCATTGAAA 64129 activate S. pyogenes 25619936 Sato
ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC 64132 activate S. pyogenes 25619936 Sato
Asip R. norvegicus ATGACAGGAGTCTAACTCAC 60968 cut S. pyogenes 24967838 Mashimo
ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall
ATM H. sapiens TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes 24954249 Yamamoto
avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello
avr-15 C. elegans GTTTGCAATATAAGTCACCC 58982 cut S. pyogenes 24879462 Mello
AXIN2 H. sapiens TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto
BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut S. pyogenes 25543152 Hanna
BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu
BT1854 B. thetaiotaomicron ATTGAAGAACAAAAGCAGTT 68891 interfere S. pyogenes 26918244 Lu
C16orf80 H. sapiens CGATGCTGTAGAGGATGGAG 70650 cut S. pyogenes 26472758 Sabatini
C16orf80 H. sapiens TGTCTGAGAAGTAAACCCGT 70651 cut S. pyogenes 26472758 Sabatini
C3orf17 H. sapiens GGGCCAAATGGGGTTTGTGG 70653 cut S. pyogenes 26472758 Sabatini
C3orf17 H. sapiens GTGTGAGAATCCCTAAGGCG 70652 cut S. pyogenes 26472758 Sabatini
C9orf114 H. sapiens CAGGCGGGCTCACCTCCGTG 70654 cut S. pyogenes 26472758 Sabatini
C9orf114 H. sapiens GCGGCAGAGAAGGAGGACCG 70655 cut S. pyogenes 26472758 Sabatini
CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes 23460208 Church
CD71 H. sapiens GGACGCGCTAGTGTGAGTGC 46918 interfere S. pyogenes 23849981 Qi
CDH1 H. sapiens TGACTTGCGAGGGACGCATT 58781 cut S. pyogenes 24954249 Yamamoto
CDKN1B H. sapiens GAAGCCGGGACCTGGACCAG 60905 activate S. pyogenes 25307933 Vale
CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall
CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall
Cent1 M. musculus GGCAACGTTTGACTTCCTGA 50718 cut S. pyogenes 24284873 Ikawa
CFTR H. sapiens TCTGTATCTATATTCATCAT 58783 cut S. pyogenes 24954249 Yamamoto
CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall
CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall
csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong
Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912 cut S. pyogenes 25119044 Jacks
Ctnnb1 M. musculus CTGTGGTGGTGGCACCAGAA 59911 cut S. pyogenes 25119044 Jacks
CXCR4 H. sapiens GCAGGTAGCAAAGTGACGCCGA 46917 interfere S. pyogenes 23849981 Qi
CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae TATAGTAATTTATGCTGCAA 64383 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae TGCAAAGGTCCTAATGTATA 64384 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu
CYC1m promoter S. cerevisiae TTACTGTATGTACATACAGT 64378 activate S. pyogenes 23977949 Lu
ddx19 D. rerio GGCAACAGATTCGTGGGCCC 47932 cut S. pyogenes 23918387 Wente
DDX3Y H. sapiens GCAGTTTAGCGATATTGACA 70656 cut S. pyogenes 26472758 Sabatini
DDX3Y H. sapiens TCTTGTTGGGGCTAAAACCA 70657 cut S. pyogenes 26472758 Sabatini
DNMT3A H. sapiens GAGATGATCGCCCCTTCTTC 41822 cut S. pyogenes 23287722 Church
DNMT3A H. sapiens GCATGATGCGCGGCCCAAGG 41821 cut S. pyogenes 23287722 Church
DNMT3B H. sapiens GAATTACTCACGCCCCAAGG 41823 cut S. pyogenes 23287722 Church
dpy-10 C. elegans CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire
dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut S. pyogenes 26044730 Katic
dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire
dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire
dpy‐10 C. elegans GCTACCATAGGCACCACGAG 70047 cut S. pyogenes 26187122 Seydoux
drd3 D. rerio GGAAACTACAGCCCAGCGTC 42242 cut S. pyogenes 23360964 Joung
Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740 Christiaen
EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung
EGFP A. victoria GAAGTTCGAGGGCGACACCC 51764 cut S. pyogenes 24336571 Zhang
EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang
EGFP A. victoria GATGCCGTTCTTCTGCTTGT 47512 cut S. pyogenes 23792628 Joung
EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang
EGFP A. victoria GGCCACAAGTTCAGCGTGTC 51762 cut S. pyogenes 24336571 Zhang
EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene
EGFP A. victoria GGGCACGGGCAGCTTGCCGG 46760 cut S. pyogenes 23918387 Chen
EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung
EGFP A. victoria GGGCGAGGAGCTGTTCACCG 51760 cut S. pyogenes 24336571 Zhang
EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang
EGFP A. victoria GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung
EGFP A. victoria TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes 24870050 Goncalves
Emx1 H. sapiens 42337 cut S. pyogenes 23287718 Zhang
EMX1 H. sapiens GAGTCCGAGCAGAAGAAGAA 47508 cut S. pyogenes 23792628 Joung
ETC2, TRY, and CPC A. thaliana 71288 cut S. pyogenes 26193878 Chen
FANCF H. sapiens GGAATCCCTTCTGCAGCACC 47510 cut S. pyogenes 23792628 Joung
fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux
fbf-2 C. elegans TAATCATCGCCGTGACTAC 65591 cut S. pyogenes 25249454 Seydoux
fh D. rerio GGAGCGAGCGGAGCGGTACA 42244 cut S. pyogenes 23360964 Joung
fh D. rerio GGAGCGGTACATGGCGACCG 42243 cut S. pyogenes 23360964 Joung
GABPA H. sapiens GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall
GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes 26355004 Mendenhall
GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi
GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT 46915 activate S. pyogenes 23849981 Qi
GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato
GAL4UAS TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato
GAL4UAS TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes 25619936 Sato
gfap D. rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes 25849248 Du
GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi
GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church
GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes 23287722 Church
GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn
gp78 H. sapiens GCCCAGCCTCCGCACCTACA 61833 cut S. pyogenes 24424410 Ye
gsk3b D. rerio GGGACCTGACCGGCCGCAGG 42245 cut S. pyogenes 23360964 Joung
his3 S. cerevisiae ATTGCGATCTCTTTAAAGGG 64333 cut S. pyogenes 25281382 Jin
HPRT H. sapiens GACTGTAAGTGAATTACTT 69539 cut S. pyogenes 26130722 Yan
HPRT1 H. sapiens CTGATAAAATCTACAGTCAT 58778 cut S. pyogenes 24954249 Yamamoto
HPRT1 H. sapiens TTATGCTGAGGATTTGGAAA 58771 cut S. pyogenes 24954249 Yamamoto
IL1RN H. sapiens TGGACGCAGATAAGAACCAGTT 64142 activate S. pyogenes 25619936 Sato
IL1RN H. sapiens TGGCATCAAGTCAGCCATCAGC 64151 activate S. pyogenes 25619936 Sato
IL1RN H. sapiens TGGGAGTCACCCTCCTGGAAAC 64152 activate S. pyogenes 25619936 Sato
IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato
inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue
inverted GFP A. victoria GATATCGAATTCCTGCAGCC 66583 cut S. pyogenes 26018130 Xue
inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue
inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue
IRF1 H. sapiens CCGGGGGCGCTGGGCTGTCCCGG 61079 purify S. pyogenes 23942116 Fujii
IRF1 H. sapiens GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii
JAK2 amplicon  H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes 26472758 Sabatini
K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux
K08F4.2 C. elegans CACGAGGTGGTATGCGCAG 66095 cut S. pyogenes 25249454 Seydoux
K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux
K08F4.2 C. elegans GCCTTAACCCAGAATAAGA 66087 cut S. pyogenes 25249454 Seydoux
K08F4.2 C. elegans TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux
KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe
Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo
Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo
Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S. pyogenes 24967838 Mashimo
klp-12 C. elegans GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco
Kras, p53, and Lkb1 M. musculus multiple, see article 60224 cut S. pyogenes 25263330 Zhang
LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330 Zhang
lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron
lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron
leu2 S. cerevisiae AATCACAGCCGAAGCCATTA 64332 cut S. pyogenes 25281382 Jin
Lkb1 M. musculus GTGGTGGGCCGCAGTCACAA 66894 cut S. pyogenes 26178787 Winslow
Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue
Lox-STOP-Lox synthetic GCGTATAGTACACATTATACG 66585 cut S. pyogenes 26018130 Xue
LRTM2 H. sapiens GCTGGCGGAAGACAGAGTGC 69237 cut S. pyogenes 26480473 Wolfe
LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate
Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna
Mettl14 M. musculus GCGGCAGCTCCTAGCTCAGC 61515 nick S. pyogenes 25569111 Hanna
mitf S. scrofa  CTTTCGGATATAATCCACGG 69801 cut S. pyogenes 26293209 Zhao
mitfa D. rerio GGTCTCTCGCAGGATGTTGC 47931 cut S. pyogenes 23918387 Chen
mKate synthetic ATGAGAATCAAGGCGGTCGA 62715 cut S. pyogenes 25527740 Bleris
MUC4 H. sapiens GTGGCGTGACCTGTGGATGCTG 51025 visualize S. pyogenes 24360272 Qi
MYOD1 H. sapiens TGGCCTCCCTCCCTGCCCGGTAG 64138 activate S. pyogenes 25619936 Sato
MYOD1 H. sapiens TGGGAGGTTTGGAAAGGGCGTGC 64139 activate S. pyogenes 25619936 Sato
MYOD1 H. sapiens TGGGCCTGGGCTCCGGGGCGTTT 64136 activate S. pyogenes 25619936 Sato
MYOD1 H. sapiens TGGGGGCCCCTGCGGCCACCCCG 64137 activate S. pyogenes 25619936 Sato
NANOG H. sapiens TGGCATATTCCTGATTTAAAAGT 64156 activate S. pyogenes 25619936 Sato
NANOG H. sapiens TGGCGCCAGGAGGGGTGGGTCTA 64153 activate S. pyogenes 25619936 Sato
NANOG H. sapiens TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato
NANOG H. sapiens TGGTGTCTTCAGGTTCTGTTGCT 64155 activate S. pyogenes 25619936 Sato
NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu
NanoLuc synthetic GACAGAACGATGCGCTGAAT 68898 interfere S. pyogenes 26918244 Lu
NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu
NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu
NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes 25240928 Lu
negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu
negative control M. musculus GCGAGGTATTCGGCTCCGCG 66895 cut S. pyogenes 26178787 Winslow
negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740 Christiaen
negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris
negative control H. sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe
Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787 Winslow
NeuN M. musculus TCCGGTTCAGGGACCCCGAC 60227 cut S. pyogenes 25263330 Zhang
Neurog2 H. sapiens GTCTCTATCACTGATAGGGA 64161 activate S. pyogenes 25619936 Sato
Neurog2 H. sapiens GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato
Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere S. pyogenes 24346702 Wolfe
Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S. pyogenes 24346702 Wolfe
Pal1 synthetic GCTCTGTGACTAGTCACAGAG 71483 cut S. pyogenes 26527385 Sherwood
Pal7 synthetic GGCTTAGTACTAGTACTAAGC 71484 cut S. pyogenes 26527385 Sherwood
PAX6 H. sapiens GATACTGGAGAAGCAGGGGC 68466 cut S. pyogenes 26145478 Zhang
PAX6 H. sapiens GTAGATTTTGTATGCACTGC 68465 cut S. pyogenes 26145478 Zhang
PcfiA AAACAAAACCTCATCAGGCA 68900 interfere S. pyogenes 26918244 Lu
PcfiA GAAGCTCACTCCTTAGCACG 68899 interfere S. pyogenes 26918244 Lu
PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun
PDS1 N. benthamiana multiple, see article 49772 cut S. pyogenes 24112467 Kamoun
PDS3 A. thaliana GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339 Sheen
pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach
pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes 25491644 Ward
PLXNB2 H. sapiens GGGCCCAACCTAGGGCATGG 69240 cut S. pyogenes 26480473 Wolfe
PM19 H. vulgare GCTCTCCACTCTGGGCTCTT 68253 cut S. pyogenes 26616834 Patron
PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron
Prnp M. musculus GGTGGAACACCGGTGGAAGC 61857 cut S. pyogenes 25490046 Schmitt-Ulms
Prnp M. musculus TTGGCCCCATCCACCGCCAT 61856 cut S. pyogenes 25490046 Schmitt-Ulms
Pten M. musculus AGATCGTTAGCAGAAACAAA 59909 cut S. pyogenes 25119044 Jacks
Pten M. musculus GCTGTAGTAATATCTGCTAT 66588 cut S. pyogenes 26018130 Xue
Pten M. musculus GTTTCATAGCGGCCACGAAGT 66587 cut S. pyogenes 26018130 Xue
RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall
rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire
rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire
rde-1(H974) C. elegans GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 Fire
rgs4 D. rerio GGAGAAGGTGAAGGACACTG 42246 cut S. pyogenes 23360964 Joung
RNF2 H. sapiens GTCATCTTAGTCATTACCTG 47509 cut S. pyogenes 23792628 Joung
rol-6(su1006) C. elegans GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire
Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn
rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini
scramble synthetic AACCCCTGATTGTATCCGCA 62285 interfere S. pyogenes 25422271 Voigt
slc24a5 (golden) D. rerio GGTCTCTCGCAGGATGTTGC 47930 cut S. pyogenes 23918387 Chen
SOX17 H. sapiens GCCCAGCCCGGCCATCACCG 59725 cut S. pyogenes 25543152 Hanna
Sox17 H. sapiens GCTCCGGCTAGTTTTCCCGG 50925 activate S. pyogenes 24346702 Wolfe
Sox17 H. sapiens GGAGGGGCAAGGGGCGGGCG 50924 activate S. pyogenes 24346702 Wolfe
Sox17 H. sapiens GGGCAAGTACGTCGATTCCA 50926 activate S. pyogenes 24346702 Wolfe
Sox17 H. sapiens GGGCGTGGGCCTAACGACGC 50923 activate S. pyogenes 24346702 Wolfe
sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire
sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT 60212 cut S. pyogenes 25161212 Fire
sv40 promoter synthetic CATACTTCTGCCTGCTGGGGAGCCTG 62338 activate/interfere S. pyogenes 25533786 Qi
SV40.NT1 H. sapiens GAATAGCTCAGAGGCCGAGG 62340 scaffold S. pyogenes 25533786 Qi & Lim
swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux
swan-2 C. elegans TGAAGAAAGTTATACTCGA 66099 cut S. pyogenes 25249454 Seydoux
T (BRACHYURY) H. sapiens CACGCGCAGTTCGCGCTCTG 59726 cut S. pyogenes 25543152 Hanna
TEF S. cerevisiae TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim
TEF1 S. cerevisiae TTGATATTTAAGTTAATAAA 46922 interfere S. pyogenes 23849981 Weissman
telomeres H. sapiens GTTAGGGTTAGGGTTAGGGTTA 51024 visualize S. pyogenes 24360272 Qi
TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim
TET promoter TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman
Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere S. pyogenes 25533786 Qi
TGM2 H. sapiens CCTGGACCCAACGCCCCAGG 69239 cut S. pyogenes 26480473 Wolfe
TGME49_290860 T. gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes 25480939 Sibley
th D. rerio GGATGCGCGTAAGGAGCGCG 42247 cut S. pyogenes 23360964 Joung
th D. rerio GGGTTGTTACACTCATAAAG 65565 cut S. pyogenes 25849248 Du
tia1l D. rerio GGTATGTCGGGAACCTCTCC 42248 cut S. pyogenes 23360964 Joung
tph1a D. rerio GGGAAAACACAACCGCAGCC 42249 cut S. pyogenes 23360964 Joung
TRE3G H. sapiens GTACGTTCTCTATCACTGATA 62325 scaffold S. pyogenes 25533786 Qi & Lim
trp1 S. cerevisiae GTCAATTGTTCTCTTTCTAT 64331 cut S. pyogenes 25281382 Jin
Trp53 M. musculus CCTCGAGCTCCCTCTGAGCC 59910 cut S. pyogenes 25119044 Jacks
TS2 H. sapiens GACCCCCTCCACCCCGCCTC 69234 cut S. pyogenes 26480473 Wolfe
TS3 H. sapiens GGTGAGTGAGTGTGTGCGTG 69235 cut S. pyogenes 26480473 Wolfe
TS4 H. sapiens GAGTCCGAGCAGAAGAAGAA 69236 cut S. pyogenes 26480473 Wolfe
ttTi5605 Mos1 insertion site C. elegans ATATCAGTCTGTTTCGTAA 47550 cut S. pyogenes 23995389 Goldstein
tyr D. rerio CCCCAGAAGTCCTCCAGTCC 46761 cut S. pyogenes 23918387 Chen
tyr D. rerio GGACTGGAGGACTTCTGGGG 64250 cut S. pyogenes 25855067 Chen
Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S. pyogenes 24967838 Mashimo
Tyr (wild type) R. norvegicus TTTCCAGGATTACGTAATAG 60967 cut S. pyogenes 24967838 Mashimo
unc-109(n499) C. elegans GGAACTCGTGTCAAAACAAC 59932 cut S. pyogenes 25161212 Fire
unc-119 C. elegans GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco
unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut S. pyogenes 24879462 Mello
unc-58(e665) C. elegans TCCACGCACATGGTCACTA 59931 cut S. pyogenes 25161212 Fire
ura3 S. cerevisiae GAGTAAAAAATTGTACTTGG 64330 cut S. pyogenes 25281382 Jin
USP13 H. sapiens GCCGCCCGGCATGCCGAACA 61812 cut S. pyogenes 24424410 Ye
VEGF H. sapiens GACCCCCTCCACCCCGCCTC 47506 cut S. pyogenes 23792628 Joung
VEGF H. sapiens GGGTGGGGGGAGTTTGCTCC 47505 cut S. pyogenes 23792628 Joung
VEGF H. sapiens GGTGAGTGAGTGTGTGCGTG 47507 cut S. pyogenes 23792628 Joung
VR synthetic TGCGCTCGGTCGTTCGGCTG 62286 interfere S. pyogenes 25422271 Voigt
Y61A9LA.1 C. elegans GGATGGATGTGTAGTCAATT 61250 cut S. pyogenes 25491644 Ward
yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu
near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes 25155555 Cepko
ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S. pyogenes 26541286 Voytas
BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes 26472758 Sabatini
BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš
Non-targeting H. sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš
AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki
mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S. pyogenes 26429889 Katsanis
GFPmut3b A. victoria ACCATCTAATTCAACAAGAATT 73221 interfere S. pyogenes 26689101 Hudson
pgi C. glutamicum TGACCGATCATTACTCAAACTTCC 74066 interfere S. pyogenes 26829286 Lu
pgi C. glutamicum TTGCCTGGAAGTTTGAGTAATGAT 74067 interfere S. pyogenes 26829286 Lu
pck C. glutamicum AGGGCGAGGCGCCGACCAAGAATA 74068 interfere S. pyogenes 26829286 Lu
pck C. glutamicum TCCAGTTCAGCAGTTCCTTATTCT 74069 interfere S. pyogenes 26829286 Lu
pyk C. glutamicum AGATTGTATGTACCCTAGGCCCAG 74070 interfere S. pyogenes 26829286 Lu
pyk C. glutamicum ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes 26829286 Lu
rfp AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu
LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes 26627737 Moffat
PSMD1 H. sapiens TGTGCGCTACGGAGCTGCAA 74180 cut S. pyogenes 26627737 Moffat
PSMD1 H. sapiens ACCAGAGCCACAATAAGCCA 74181 cut S. pyogenes 26627737 Moffat
PSMB2 H. sapiens ATGTTCTTGTCGCCTCCGAC 74184 cut S. pyogenes 26627737 Moffat
PSMB2 H. sapiens AATATTGTCCAGATGAAGGA 74185 cut S. pyogenes 26627737 Moffat
EIF3D H. sapiens TGTAGGTTGCCTCCATGGCC 74187 cut S. pyogenes 26627737 Moffat
EIF3D H. sapiens AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat
Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat
AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw
AMPK alpha 1 H. sapiens GAAGATCGGCCACTACATTC 74375 nick S. pyogenes 26816379 Shaw
AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw
AMPK alpha 2 H. sapiens GAAGATCGGACACTACGTGC 74377 nick S. pyogenes 26816379 Shaw
ACTB H. sapiens UGGAGCGAGCAUCCCCCAAA 74705 RNA targeting S. pyogenes 26997482 Yeo
TFRC H. sapiens GCACUGACCAGAUAAGAAUG 74709 RNA targeting S. pyogenes 26997482 Yeo
AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn
AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC cut S. pyogenes 26789497 Corn
BFP ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn
EMX1 H. sapiens CGATGTCACCTCCAATGACT cut S. pyogenes 26789497 Corn
CCR5 H. sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn
CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S. pyogenes 26789497 Corn
AOC N. attenuata CAAAAGACTGTCAATTCCCT cut S. pyogenes 26479191 Kim
PHYB A. thaliana CACTAGGAGCAACACCCAA cut S. pyogenes 26479191 Kim
P450 O. sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim
DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes 26479191 Kim
DWD1 O. sativa CTACGACGTCAGGTTCTACC cut S. pyogenes 26479191 Kim
BRI1 A. thaliana TTTGAAAGATGGAAGCGCGG cut S. pyogenes 26479191 Kim
BRI1 A. thaliana TGAAACTAAACTGGTCCACA cut S. pyogenes 26479191 Kim
BIN2 L. sativa ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim
tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson
OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson
Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N. meningitidis 24076762 Church
Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis 24076762 Church
Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church
Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church
Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church
Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church
UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley
GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson
Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson
Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson
Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson
Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson
Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: AATGTGAAGGACTTTCGTAA 72624 cut S. pyogenes 26493208 Guigo, Johnson
TFRC H. sapiens gRNA1:GCAGCCTCAGAAATACAAAA, gRNA2CGGGATATCGGGTGGCGGCT 72626 cut S. pyogenes 26493208 Guigo, Johnson
TCRC H. sapiens gRNA1:GGGGAGCGGGAAAGCGGTCG; gRNA2:AACTGACCTTCAGGCCCGTA 72627 cut S. pyogenes 26493208 Guigo, Johnson
UCA1 H. sapiens gRNA1:GGTTTCCTTTTAGATGACGG; gRNA2:TCTGAAAAGAGAGTCAGCGA 72628 cut S. pyogenes 26493208 Guigo, Johnson
GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere S. pyogenes 26689101 Hudson
xylR C. beijerinckii CGAGTTAGACATAATAGTGA 73228 nick S. pyogenes 27213844 Yang
RIPK1 H. sapiens GCTCTGCTGGGAAGCGAATC 75163 cut S. pyogenes 27194728 Bornhauser
Caspase-8 H. sapiens GCCTGGACTACATTCCGCAA 75164 cut S. pyogenes 27194728 Bornhauser
RIP3 H. sapiens TACACGAGTGATGGTTCGGT 75165 cut S. pyogenes 27194728 Bornhauser
FADD H. sapiens ACTCCCGCACACGCTCTGTC 75166 cut S. pyogenes 27194728 Bornhauser
MLKL H. sapiens ATCCCCGTGGATTCTGCTAA 75167 cut S. pyogenes 27194728 Bornhauser
Prkaa1 M. musculus TTATTGTCACAGGCATATGG 79004 cut S. pyogenes 26944679 Shaw
Prkaa2 M. musculus ACAGGCATATGGTTGTCCAT 79005 cut S. pyogenes 26944679 Shaw
Tfeb M. musculus AGCACTGTTGCCGGCCGAGG 79006 cut S. pyogenes 26944679 Shaw

Please refer to the primary article to confirm details and outcomes.

Submit Validated gRNA Sequences

Validated gRNA sequences can be added to this table from any peer reviewed publication. To add validated gRNA sequences to our datatable, please download the following spreadsheet, fill out as much information as possible on the sequences, and email the file to [email protected] with the subject heading "gRNA sequence spreadsheet". Thanks for helping us expand and improve our resources!

Download validated gRNA sequence spreadsheet