Skip to main content
Addgene

We narrowed to 51 results for: GRN

Showing: 1 - 20 of 51 results
  1. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila... CRISPR gRNAs CRISPR Plasmids: gRNAs Browse CRISPR Plasmids...Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA plasmids designed to... questions to consider when choosing a gRNA: Does a given gRNA sequence exactly match your genomic target...Variation between a given gRNA sequence and your genomic target may reduce the gRNA activity. The variety ...pyogenes , S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible...gRNA expression vectors available from Addgene. CRISPR...
  2. Validated gRNA Sequences

    Type
    Collection
    ... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA Target...Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have...Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA sequence and...pyogenes, S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible...indicate the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene...pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA 72619 cut S... Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: GGCAGGAGAGGCCAGTTGCG 72620 cut S...
  3. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...Type Species PI Lentiviral Generation gRNAs per gene Total gRNAs Adamson DNA Repair CRISPRi Libraries ...Reduced Double-gRNA Library 137999 Knockout Human Parts 3rd 3 59,576 Human Whole Genome sgRNA iBAR Library...46,354 BARBEKO sgRNA Library 174163 Knockout, Base Editing Human Wei 3rd 3 53,502 sgRNA Pool for Streptococcus...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR is a useful...experiments, due to the relative ease of designing gRNAs and the ability to modify virtually any genetic ...thousands of plasmids, each containing multiple gRNAs for each target gene. In a CRISPR screening...
  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...genome. gRNA Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector...expression of more sgRNAs in a single vector. sgRNAs are expressed as polycistronic glycine tRNA-gRNA genes (PTGs...Empty gRNA expression vectors for insertion of custom gRNA target sequences. CRISPR...target-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and a Cas ...pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock and Port pAc-sgRNA-Cas9 49330...S. pyogenes Joung pSPgRNA 47108 Mammalian BbsI none S. pyogenes Gersbach pUC57-sgRNA expression vector...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Halo_C_allele HNRNPA1 Halo ALS Michael Ward 178125 GRN_Halo_C_allele GRN Halo Frontotemporal dementia (FTD) Michael... HNRNPA1 His T7 ALS Tanja Mittag 178944 pAAV-mGrn-myc GRN Myc CBA Frontotemporal dementia (FTD) Erik Roberson... Parkinson's Frank Soldner 180439 STR-KDEL_PGRN-SBP-mCherry GRN SBP-mCherry CMV Frontotemporal dementia...Castañeda 176915 pcDNA3.1(+)_Paragranulin+linker 1 GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas... Kukar 176917 pcDNA3.1(+)_Paragranulin-no linker GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...Thomas Kukar 176918 pcDNA3.1(+)_Granulin 1+linker2 GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...Thomas Kukar 176919 pcDNA3.1(+)_Granulin 1-no linker GRN Flag, Strep CMV Frontotemporal dementia (FTD) Thomas...
  6. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...find a gRNA vector based on expression system, promoter, the type of gRNA (e.g., pegRNA, epegRNA, nicking... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...using a prime editing guide RNA (pegRNA). As with a typical gRNA, the pegRNA is designed with a spacer that...PEmax to enhance pegRNA stability epegRNA - additional protection added to 3’ tail of pegRNA to prevent RNA...nicking sgRNA BbsI No Vermilion Norbert Perrimon 164423 pHSG1C3 Mammalian U6 pegRNA + nicking sgRNA BbsI ...BbsI for sgRNAs; BbsI + PstI for pegRNAs No Xiao Wang 170132 pOsU3 Plant OsU3 pegRNA BsaI + HindIII No Caixia...172716 pPEgRNA Bacteria J23119 (BBa_J23119) pegRNA SpeI + HindIII No Tilmann Weber 172717 pnsgRNA Bacteria...
  7. Zhang Lab CRISPR Page

    Type
    Collection
    ...described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro (sgRNA) Browse...CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600; CMV-driven... SaCas9 sgRNA can be co-transfected as PCR amplicons using a protocol similar to SpCas9 sgRNA PCR (Ran... pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH...implemented by delivering Cre and sgRNA to a Cre-dependent mouse or sgRNA to a constitutively Cas9-expressing...control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone...
  8. CRISPR References and Information

    Type
    Collection
    ...Cas9 ; pUC gRNA Shuttle PDF, 500 KB Sabatini and Lander gRNA cloning into pLX-sgRNA pLX-sgRNA PDF, 129 ...at Addgene Church gRNA design and cloning gRNA cloning vector PDF, 118 KB Church gRNA design and cloning...Nematode: Cas9 and gRNA use Cas9 (pIK86) ; gRNA empty backbone (pDR274) PDF, 89 KB Liu Fly: gRNA cloning pAc-...Chen and Wente Zebrafish: gRNA cloning, in vitro transcription, injection gRNA core ; Cas9 ; optimized ...optimized Cas9 PDF, 66.8 KB Fujii gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo...dCas9 PDF, 110 KB Goldstein Nematode: gRNA design and cloning Cas9-sgRNA construct PDF, 364 KB Goldstein Nematode... cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles Fly: gRNA and ssODNs design and...
  9. Plan Your Experiment

    Type
    Collection
    ...edit type, designing and cloning a gRNA, delivering Cas and the gRNA, and validating the edit.... system for Cas9 and the guide RNA (gRNA), the design of the gRNA sequence, and finally how to validate... proper gRNA design. While there are some cases where it makes sense to manually design a gRNA, in most...most cases gRNA design software is better and more efficient at designing potential gRNAs for you to choose...testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA designs is particularly...your gRNA is the balance between on-target and off-target activity. In a perfect world, your gRNA sequence...mismatches between a given gRNA sequence and your genomic target may reduce the gRNA activity. Be sure to sequence...
  10. CRISPR Guide

    Type
    Collection
    ... guide RNA ( gRNA or sgRNA ) and a CRISPR-associated endonuclease (Cas enzyme). The gRNA is a short synthetic...conversions using a prime editing guide RNA ( pegRNA ). Like sgRNA, pegRNA directs the nickase to the target site... of unique gRNAs. gRNA design for CRISPR libraries is usually optimized to select for gRNAs with high ...commonly referred to as an sgRNA. gRNA scaffold sequence The sequence within the gRNA that is responsible for...amplify a specific sequence of DNA pegRNA P rime E dit gRNA; a specialized gRNA containing an additional primer...Cas enzyme and a gRNA specific to the gene of interest. The genomic target of the gRNA can be any ~20 nucleotide...interactions between the gRNA scaffold and surface-exposed positively-charged grooves on Cas9. gRNA binding induces...
  11. CRISPR Plasmids - Plants

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3-gRNA maize U3 none S. pyogenes...
  12. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Publication Empty gRNA Expression Vectors You can use the tables on Addgene's Empty gRNA Vectors page to...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  13. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ....1016/j.bbrc.2013.08.013. Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  14. CRISPR Plasmids - Drosophila

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...conversions using a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  15. CRISPR Plasmids - Yeast

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...using does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Selectable Marker PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...
  16. Lentiviral Prep Service

    Type
    Collection
    ...pooled libraries 73178 Human sgRNA library Brunello in lentiGuide-Puro Human sgRNA library in backbone lentiGuide-Puro... Doench , Root 73179 Human gRNA pooled library in lentiCRISPRv2 Human sgRNA library in backbone lentiCRISPRv2...Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa sgRNA activation...containing 56,762 unique sgRNAs. This backbone does not contain dCas9. 56,762 unique sgRNAs targeting 18,885 ...pooled libraries 73633 Mouse sgRNA library Brie in lentiGuide-Puro Mouse sgRNA library in backbone lentiGuide-Puro...RNA guide (gRNA) that harbors targeting sequences. Browse our repository for a list of gRNA plasmids targeting...targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone...
  17. CRISPR Plasmids - C. elegans

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...choose does not also express a gRNA, you will need to use a separate gRNA expression plasmid to target ...Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR...double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially...flanking the DSB and a specific edit close to the gRNA PAM site. When a repair template is present, the...
  18. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...example, sgRNA-A’s protospacer sequence and PAM happen to fall on the bottom (Crick) strand while sgRNA-B’s...primers flanking each sgRNA target site (within 150 - 350 bp) to amplify the sgRNA target site to examine...complement: 1.0 μl sgRNA 24- or 25-mer oligo (100 μM; see step 1.4 ), 1.0 μl sgRNA 24- or 25-mer reverse...composed of a polyclonal population exposed to sgRNA-A and sgRNA-B (see step 5 ). The purpose of the following...delivery of a pair of chimeric single guide RNAs (sgRNAs) to create two double strand breaks (DSBs) at a...posted at the top of the page. CRISPR Design Design sgRNAs manually or using freely available online tools...non-coding elements. For creating a gene knockout, two sgRNA located within exons will enrich even monoallelic...
  19. CRISPR Plasmids - Tagging

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...expresses Cas9 & PITCh-gRNA pX330A-FBL/PITCh - expresses Cas9, PITCh-gRNA, & FBL-specific gRNA pCRIS-PITChv2-FBL...containing Cas9 and a validated gRNA, based on the Zhang lab's PX458 . Multiple gRNA plasmids may be used. The...Plasmids Protein Species Tag Donor Plasmid gRNA plasmid gRNA plasmid FLAG pFETCh_Donor CEBPB Human FLAG...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR system...unavailable, you will need to design and clone in a gRNA(s) to guide the Cas9 protein to your target sequence...Addgene 41815 or #44719 ) in combination with gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector...
  20. CRISPR Plasmids - Xenopus

    Type
    Collection
    ... dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila...Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression plasmid based on factors...-specific gRNA in the same cell at the same time. Single plasmids containing both the gRNA and Cas protein...CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR...) at a specific location based on a co-expressed gRNA-defined target sequence. DSBs are preferentially...surrounding the DSB is introduced along with the Cas9 and gRNA plasmids, the cell may instead repair the break ...single category (cut, nick, etc.) On the other hand, gRNA plasmids that do not co-express a Cas protein can...
Showing: 1 - 20 of 51 results