We narrowed to 7 results for: Mela
-
TypeCollection...TNFR-RP, TNFR2-RP, TNFRSF3 MC1R melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) ...SHEP2 MC2R melanocortin 2 receptor (adrenocorticotropic hormone) ACTHR, MGC125798 MC3R melanocortin 3 receptor...MC3-R, OB20, OQTL MC4R melanocortin 4 receptor MGC126851, MGC138197 MCHR1 melanin-concentrating hormone...MSTN myostatin GDF8 MTNR1A melatonin receptor 1A MEL-1A-R, MT1 MTNR1B melatonin receptor 1B MEL-1B-R, MT2...PMCH pro-melanin-concentrating hormone MCH PNOC prepronociceptin PPNOC POMC proopiomelanocortin ACTH, CLIP...GPRV28, V28 CXCL1 chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha) FSP, GRO1,...
-
Neurodegeneration Plasmid Collection
TypeCollection...T7 Huntington's Pamela Bjorkman 11514 pET32a-HD39Q HTT His, Trx T7 Huntington's Pamela Bjorkman 11515 ...11487 pET32a-HD16Q HTT His, Trx T7 Huntington's Pamela Bjorkman 11503 pBabe neo human Frataxin FXN Friedreich...11515 pET32a-HD46Q HTT His, Trx T7 Huntington's Pamela Bjorkman 12165 pSico Dnmt1 DNMT1 GFP CMV Hereditary... -
Synthetic Biology - Overview
TypeCollection...Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela Silver Lei Stanley Qi Jeff Tabor Jan-Willem Veening... -
TALEN Plasmids and Kits
TypeCollection...germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 - 49647 24 plasmids... -
CRISPR Pooled gRNA Libraries
TypeCollection...Neelamegham 3rd 10 3,637 Oxford Fly 64750 Knockout D. melanogaster Liu N/A 3 40,279 Pan-Druggable Cancer Library... -
Validated gRNA Sequences
TypeCollection...61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186... -
CRISPR Guide
TypeCollection...A., Waldhauer, M. C., Börner, K., Fakhiri, J., Schmelas, C., Dietz, L., Grimm, D., Correia, B. E., Eils...