Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 2 results for: p53 luciferase p53 luc reporter

Showing: 1 - 2 of 2 results

  1. Luciferase Plasmid Collection

    Type
    Collection
    ...CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina luciferase). Feng Zhang Return... of luciferase found in Addgene's collection include: Firefly luciferase (Fluc) Renilla luciferase (Rluc...Multiple Multiple Multi-luciferase reporter vector including five transcriptional reporters for NF-kb, TGF-b,...Gaussia luciferase (Gluc) NanoLuc® (Nluc) The mammalian codon-optimized version of firefly luciferase is often...CBRluc and CBGluc , respectively), Cypridina luciferase , and Luciola luciferase . Each type of luciferase...Firefly luciferase. Renilla luciferase is co-expressed. Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation...process. Lynne Postovit 64034 pGL4Luc-RLuc Firefly, Renilla Dual reporter reporter vector allowing the study...

  2. Validated gRNA Sequences

    Type
    Collection
    ...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article 60224...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes 23287722 Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display...GTCAATTGTTCTCTTTCTAT 64331 cut S. pyogenes 25281382 Jin Trp53 M. musculus CCTCGAGCTCCCTCTGAGCC 59910 cut S. pyogenes...
Showing: 1 - 2 of 2 results