Skip to main content
Addgene
Showing: 1 - 2 of 2 results

  1. Luciferase Plasmid Collection

    Type
    Collection
    ...types of luciferase found in Addgene’s collection are Firefly luciferase (Fluc), Renilla luciferase (Rluc...Renilla luciferase in plants Diego Orzaez 118069 MLRV Multiple Multiple Multi-luciferase reporter vector...transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen Venken ...), and NanoLuc® Luciferase (Nluc). Luc2 is the second-generation version of Firefly luciferase that has...green Click-beetle luciferases (CBRluc and CBGluc, respectively). Like Firefly luciferase, Click-beetle red...Firefly luciferase. Renilla luciferase is co-expressed. Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation...Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent Imaging...

  2. Validated gRNA Sequences

    Type
    Collection
    ...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article 60224...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes 23287722 Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display...GTCAATTGTTCTCTTTCTAT 64331 cut S. pyogenes 25281382 Jin Trp53 M. musculus CCTCGAGCTCCCTCTGAGCC 59910 cut S. pyogenes...
Showing: 1 - 2 of 2 results